Este manuscrito describe la síntesis de un nanotubo de carbono de pared simple (SWCNT)-conjugado MALAT1 gapmer antisentido DNA oligonucleotide (SWCNT-anti-MALAT1), que demuestra la entrega confiable de la SWCNT y el potente efecto terapéutico de anti-MALAT1 in vitro e in vivo. Métodos utilizados para la síntesis, modificación, verbal, y la inyección de SWCNT-anti-MALAT1 se describen.
Los nanotubos de carbono de pared simple (SWCNT) es un nuevo tipo de nanopartícula, que se ha utilizado para ofrecer a varios tipos de drogas en las células, como las proteínas, oligonucleótidos y drogas sintéticas de molécula pequeña. El SWCNT tiene dimensiones personalizables, una gran área superficial y flexible puede enlazar con las drogas a través de diferentes modificaciones en su superficie; por lo tanto, es un sistema ideal para el transporte de drogas en las células. Larga noncoding RNAs (lncRNAs) son un grupo de RNA codifica más de 200 nt, que no puede ser traducido a proteína, pero juega un papel importante en procesos biológicos y fisiopatológicos. Adenocarcinoma pulmón metástasis asociadas 1 (MALAT1) es un lncRNA altamente conservado. Se demostró que niveles más altos de MALAT1 están relacionados con el pronóstico de varios tipos de cáncer, como mieloma múltiple (MM). Hemos revelado que MALAT1 regula ADN reparación y muerte celular en MM; así, MALAT1 puede considerarse como una diana terapéutica para m. Sin embargo, la entrega eficiente de oligo antisentido para inhibir/caída MALAT1 en vivo sigue siendo un problema. En este estudio, nos modificar SWCNT con PEG-2000 conjugar un oligo de anti-MALAT1 a él, prueba de la entrega de este compuesto en vitro, inyectar por vía intravenosa en un modelo de ratón MM diseminado y observar una inhibición significativa de la progresión de MM, que indica SWCNT es una entrega ideal para anti-MALAT1 gapmer ADN.
El SWCNT es un nuevo nanomaterial que puede ofrecer a varios tipos de drogas, como las proteínas, moléculas pequeñas y los ácidos nucleicos, estable y eficiente con tolerabilidad ideal y mínima toxicidad en la1 de la vitro y en vivo2. Un SWCNT funcionalizado tiene gran solubilidad en agua y biocompatibilidad, puede utilizarse como un servicio de transporte para moléculas más pequeñas y llevarlas para penetrar la membrana de la célula3,4,5.
lncRNAs son un grupo de RNA (> 200 nt) que se transcriben a mRNA de genoma, pero no puede ser traducido a proteínas. Cada vez más pruebas ha demostrado que lncRNAs participar en la regulación de la expresión de genes6 y participan en la iniciación y progresión de la mayoría de los tipos de cáncer, incluyendo MM7,8,9. MALAT1 es una transcripción codifica nuclear enriquecido 2 (NEAT2) y un altamente conservado lncRNA10. MALAT1 es reconocido inicialmente en metastásico de pulmón de células no pequeñas (CPCNP) el cáncer11, pero ha sido sobre expresa en numerosos tumores5,12,13; es uno de los lncRNAs más altamente expresada y se correlaciona con un pronóstico pobre en MM8,14. El nivel de expresión de MALAT1 es significativamente mayor en pacientes con MM extramedular curso fatal en comparación con aquellos diagnosticados sólo como MM15.
En un estudio previo, hemos confirmado que oligos de anti-MALAT1 robusta conducen a daños en el ADN y la apoptosis en MM16 mediante el uso de oligonucleótidos de antisentido del ADN de gapmer a MALAT1 (anti-MALAT1) en células de MM. La DNA gapmer es compuesta de ADN antisentido y unida por 2′-OMe-RNAs, que podrían sugerirán el escote de la MALAT1 por la Rnasa H actividad una vez atado17. La eficiencia de la entrega en vivo de oligos antisentido todavía limita su uso clínico.
Para probar la entrega efecto de SWCNT para oligos de gapmer anti-MALAT1, el gapmer anti-MALAT1 ADN se conjuga a DSPE-PEG2000-amina funcionalizados SWCNT. SWCNT-anti-MALAT1 luego se inyecta por vía intravenosa en un modelo de ratón diseminada MM; se observa una inhibición notable después de cuatro tratamientos.
La evidencia ha mostrado que lncRNAs participar en la regulación de numerosos procedimientos fisiológicos y patofisiológicos de cánceres, incluyendo el m7,8,9; tienen el potencial de ser objeto de tratamiento del cáncer, que puede ser realizado por oligonucleótidos antisentido20,21,22. La U.S. Food y Drug Administration (FDA) ha a…
The authors have nothing to disclose.
Los autores agradecen el Instituto de Investigación Lerner proteómicos, genómicos y núcleos de proyección de imagen para su ayuda y apoyo. Financiación: Este trabajo fue apoyado financieramente por la subvención del NIH/NCI R00 CA172292 (a J.J.Z.) y fondos de puesta en marcha (a J.J.Z.) y la clínica y traslacional ciencia colaborativa (CTSC) de caso Western Reserve University base utilización piloto (a J.J.Z.). Este trabajo utilizó el microscopio confocal Leica SP8 que fue comprado con fondos de los institutos nacionales de salud SIG grant 1S10OD019972-01.
SWCNTs | Millipore-Sigma | 704113 | |
DSPE-PEG2000-Amine | Avanti Polar Lipids | 880128 | |
bath sonicator | VWR | 97043-992 | |
4 mL centrifugal filter | Millipore-Sigma | Z740208-8EA | |
UV/VIS spectrometer | Thermo Fisher Scientific | accuSkan GO UV/Vis Microplate Spectrophotometer | extinction coefficient of 0.0465 L/mg/cm at 808 nm |
Sulfo-LC-SPDP | ProteoChem | c1118 | |
DTT solution | Millipore-Sigma | 43815 | |
NAP-5 column | GE Healthcare | 17-0853-01 | |
in vivo imaging system | PerkinElmer | ||
NOD.CB17-Prkdcscid/J mice | Charles River lab | 250 | |
Flow cytometer | Becton Dickinso | ||
Lipofectamine | Invitrogen | 11668019 | Lipofectamine2000 |
Fetal bovine serum (FBS) | Invitrogen | 10437-028 | |
RMPI-1640 medium | Invitrogen | 11875-093 | |
MALAT1-QF: | synthesized by IDT Company | 5’- GTTCTGATCCCGCTGCTATT – 3’ | |
MALAT1-QR: | synthesized by IDT Company | 5’- TCCTCAACACTCAGCCTTTATC – 3’ | |
GAPDH-QF: | synthesized by IDT Company | 5’- CAAGAGCACAAGAGGAAGAGAG – 3’ | |
GAPDH-QR: | synthesized by IDT Company | 5’- CTACATGGCAACTGTGAGGAG – 3’ | |
Quantitative PCR using SYBR Green PCR master mix | Thermo Fisher Scientific | A25780 | |
RevertAid first-stand cDNA synthesis kit | Thermo Fisher Scientific | K1621 | |
anti-MALAT1 | synthesized by IDT Company | 5’-mC*mG*mA*mA*mA*C*A*T*T *G*G*C*A*C*A*mC*mA*mG*mC*mA-3’ |
|
Cell Viability Assay Kit | Promega Corporation | G7570 | CellTiter-GloLuminescent Cell Viability Assay Kit |
accuSkan GO UV/Vis Microplate Spectrophotometer | Thermo Fisher Scientific | ||
centrifugal filter | Millipore-Sigma | UFC910008 | |
SPSS software | IBM | version 24.0 | |
D-Luciferin | Millipore-Sigma | L9504 |