Dieses Manuskript beschreibt die Synthese von einem einwandigen Kohlenstoff-Nanoröhrchen (SWCNT)-konjugiert MALAT1 antisense Gapmer DNA-Oligonukleotid (SWCNT-Anti-MALAT1), welche die zuverlässige Zustellung der SWCNT und potente Wirkung des zeigt Anti-MALAT1 in vitro und in vivo. Methoden zur Synthese, Modifikation, Konjugation und Injektion von SWCNT-Anti-MALAT1 werden beschrieben.
Die einwandigen Kohlenstoff-Nanoröhrchen (SWCNT) ist eine neue Art von Nanopartikel, die verwendet wurde, um mehrere Arten von Drogen in Zellen, wie Proteine, Oligonukleotide und synthetischen kleinen Molekül-Drogen zu liefern. Die SWCNT verfügt über anpassbare Dimensionen, oberflächliche großflächig und kann flexibel mit Drogen durch verschiedene Modifikationen an seiner Oberfläche binden; Daher ist es ein ideales System, Medikamente in die Zellen zu transportieren. Lange forensisches RNAs (LncRNAs) sind eine Gruppe von mehr als 200 nichtcodierender RNA nt, die nicht in Protein übersetzt werden, sondern spielen eine wichtige Rolle in biologischen und pathophysiologischen Prozessen. Metastasen-assoziierten Lunge Adenokarzinom Transkript 1 (MALAT1) ist eine hoch konservierte LncRNA. Es konnte gezeigt werden, dass höhere MALAT1 die schlechte Prognose der verschiedenen Krebsarten, einschließlich Multiples Myelom (MM) verbunden sind. Wir haben gezeigt, dass MALAT1 DNA-Reparatur und Zelle Tod im MM regelt; So können MALAT1 als ein therapeutisches Ziel für MM betrachtet werden. Die effiziente Bereitstellung von antisense Oligo zu hemmen/Zuschlag MALAT1 in-vivo ist jedoch nach wie vor ein Problem. In dieser Studie wir SWCNT mit PEG-2000 zu ändern und eine Anti-MALAT1-Oligo zu konjugieren, testen die Lieferung dieses mittels in-vitro-injizieren es intravenös in einem verbreiteten MM-Maus-Modell und beobachten eine deutliche Hemmung der MM-Progression, was darauf hindeutet Diese SWCNT ist eine ideale Lieferung-Shuttle für Anti-MALAT1 Gapmer DNA.
Die SWCNT ist eine neuartige Nanomaterialien, die verschiedenen Arten von Drogen, wie Proteine, kleine Moleküle und Nukleinsäuren, stabil und effizient mit ideale Verträglichkeit und minimale Toxizität in Vitro1 und in-vivo2liefern kann. Funktionalisierten SWCNT kann hat große Biokompatibilität und Wasser Löslichkeit, kann als ein Shuttle für kleinere Moleküle verwendet werden, und sie dringen in die Zellmembran3,4,5.
LncRNAs sind eine Gruppe von RNA (> 200 nt), die aus dem Genom zu mRNA transkribiert werden, aber nicht in Proteine übersetzt werden. Erhöhung der Beweis hat gezeigt, dass LncRNAs in der Regulation der Gene Expression6 beteiligen und engagieren sich in der Initiierung und Progression der meisten Arten von Krebs, einschließlich MM7,8,9. MALAT1 ist ein nuklearer bereichert forensisches Transkript 2 (NEAT2) und einer hoch konservierten LncRNA10. MALAT1 wird zunächst im metastasierten nicht-kleinzelligen Lungenkrebs (NSCLC) Krebs11erkannt, aber hat in zahlreichen Tumoren5,12,13überexprimiert wurden; Es ist eines der höchst exprimierten LncRNAs und korreliert mit einer schlechten Prognose in MM8,14. Die Expression des MALAT1 ist signifikant höher bei tödlichen Kurs extramedulläre MM Patienten im Vergleich zu denen nur als MM15diagnostiziert.
In einer früheren Studie haben wir bestätigt, dass Anti-MALAT1 Oligos robust zu DNA-Schäden und Apoptose in MM16 führen mithilfe von Gapmer DNA antisense Oligonucleotides targeting MALAT1 (Anti-MALAT1) in MM-Küvetten. Die Gapmer DNA besteht aus antisense-DNA und verbunden durch 2′-OMe-RNAs, die MALAT1 Spaltung durch RNase H-Aktivität nach der Bindung17veranlassen könnte. Die in-vivo Transporteffizienz antisense Oligos begrenzt noch seiner klinischen Verwendung.
Um die Lieferung zu testen SWCNT-Effekt für Anti-MALAT1 Gapmer Oligos, die Anti-MALAT1-Gapmer, die DNA zu DSPE-PEG2000-Amin konjugiert wird funktionalisiert SWCNT. SWCNT-Anti-MALAT1 wird in einem MM disseminierter Mausmodell dann intravenös injiziert; eine markante Hemmung wird nach vier Behandlungen beobachtet.
Beweis hat gezeigt, dass bei der Regulierung der zahlreiche physiologische und pathophysiologische Prozesse im Krebs, einschließlich MM7,8,9LncRNAs teilnehmen; Sie haben das Potenzial für die Krebsbehandlung, ausgerichtet werden, die von antisense Oligonukleotide20,21,22realisiert werden können. Die US Food and Drug Administration (F…
The authors have nothing to disclose.
Die Autoren der Lerner Forschungsinstitut Proteomik, genomische, und bildgebenden Kerne für ihre Hilfe und Unterstützung danken. Finanzierung: Diese Arbeit wurde von NIH/NCI Stipendium R00 CA172292 (J.J.Z.) und Startkapital (zu J.J.Z.) und die klinische und translationale Wissenschaft Collaborative (CTSC) der Case Western Reserve University Core Auslastung Pilot Grant (zu J.J.Z.) finanziell unterstützt. Dabei verwendet der Leica SP8 confocal Mikroskop, das gekauft wurde, mit finanzieller Unterstützung von nationale Institute der Gesundheit SIG Grant 1S10OD019972-01.
SWCNTs | Millipore-Sigma | 704113 | |
DSPE-PEG2000-Amine | Avanti Polar Lipids | 880128 | |
bath sonicator | VWR | 97043-992 | |
4 mL centrifugal filter | Millipore-Sigma | Z740208-8EA | |
UV/VIS spectrometer | Thermo Fisher Scientific | accuSkan GO UV/Vis Microplate Spectrophotometer | extinction coefficient of 0.0465 L/mg/cm at 808 nm |
Sulfo-LC-SPDP | ProteoChem | c1118 | |
DTT solution | Millipore-Sigma | 43815 | |
NAP-5 column | GE Healthcare | 17-0853-01 | |
in vivo imaging system | PerkinElmer | ||
NOD.CB17-Prkdcscid/J mice | Charles River lab | 250 | |
Flow cytometer | Becton Dickinso | ||
Lipofectamine | Invitrogen | 11668019 | Lipofectamine2000 |
Fetal bovine serum (FBS) | Invitrogen | 10437-028 | |
RMPI-1640 medium | Invitrogen | 11875-093 | |
MALAT1-QF: | synthesized by IDT Company | 5’- GTTCTGATCCCGCTGCTATT – 3’ | |
MALAT1-QR: | synthesized by IDT Company | 5’- TCCTCAACACTCAGCCTTTATC – 3’ | |
GAPDH-QF: | synthesized by IDT Company | 5’- CAAGAGCACAAGAGGAAGAGAG – 3’ | |
GAPDH-QR: | synthesized by IDT Company | 5’- CTACATGGCAACTGTGAGGAG – 3’ | |
Quantitative PCR using SYBR Green PCR master mix | Thermo Fisher Scientific | A25780 | |
RevertAid first-stand cDNA synthesis kit | Thermo Fisher Scientific | K1621 | |
anti-MALAT1 | synthesized by IDT Company | 5’-mC*mG*mA*mA*mA*C*A*T*T *G*G*C*A*C*A*mC*mA*mG*mC*mA-3’ |
|
Cell Viability Assay Kit | Promega Corporation | G7570 | CellTiter-GloLuminescent Cell Viability Assay Kit |
accuSkan GO UV/Vis Microplate Spectrophotometer | Thermo Fisher Scientific | ||
centrifugal filter | Millipore-Sigma | UFC910008 | |
SPSS software | IBM | version 24.0 | |
D-Luciferin | Millipore-Sigma | L9504 |