توضح هذه المخطوطة توليف أنبوب نانوي واحد-الجدار الكربون (سوكنت)-مترافق MALAT1 جابمير العقاقير الحمض النووي اليغنوكليوتيد (سوكنت-ضد-MALAT1)، مما يدل على إيصال موثوقة سوكنت وقوية التأثير العلاجي ل مكافحة–MALAT1 في المختبر والمجراه. الأساليب المستخدمة للتوليف، والتعديل، والتصريف، وشرح لحقن سوكنت-مكافحة–MALAT1.
أنبوب نانوي واحد-الجدار الكربون (سوكنت) هو نوع جديد من نانوحبيبات، التي كانت تستخدم لتقديم أنواع متعددة من المخدرات داخل الخلايا، مثل البروتينات والنوكليوتيد والعقاقير الاصطناعية جزيء صغير. سوكنت أبعادا قابلة للتخصيص، مساحة سطحية كبيرة، ويمكن ربط مرونة مع المخدرات من خلال تعديلات مختلفة على سطحه؛ ولذلك، نظام مثالي لنقل الأدوية إلى خلايا. الكشف فضله منذ فترة طويلة (لنكرناس) مجموعة من الجيش الملكي النيبالي فضله أطول من 200 nt, التي لا يمكن ترجمتها إلى البروتين ولكنها تلعب دوراً هاما في العمليات البيولوجية والفيزيولوجية المرضية. الرئة المرتبطة بورم خبيث غدية نسخة 1 (MALAT1) لنكرنا عالية مصانة. وثبت أن مستويات أعلى من MALAT1 المرتبطة بسوء التشخيص لأنواع السرطان المختلفة، بما في ذلك الورم النخاعي المتعدد (مم). ونحن قد كشفت عن أن ينظم MALAT1 الموت خلية وإصلاح الحمض النووي في مم؛ وهكذا، يمكن اعتبار MALAT1 كهدف علاجي ملم. ومع ذلك، الكفاءة في تقديم اليغو العقاقير لتمنع/ضربة قاضية MALAT1 الحية في ما زال مشكلة. في هذه الدراسة، نحن تعديل سوكنت مع الوتد-2000 ومترافق اليغو MALAT1 المضادة لأنه اختبار إنجاز هذا المركب في المختبر، حقن الوريد مع نموذج ماوس مم نشرها والتقيد تثبيط كبيرة لتطور مم، مما يشير إلى أن سوكنت مكوكية تسليم مثالي لمكافحة MALAT1 جابمير الحمض النووي.
سوكنت هو نانوماتيريال رواية التي يمكنها توفير أنواع مختلفة من المخدرات، مثل البروتينات، والجزيئات الصغيرة، والأحماض النووية، ستابلي وكفاءة مع قابلية التحمل مثالية وسمية الحد الأدنى في المختبر1 و المجراة في2. سوكنت فونكتيوناليزيد كبيرة ذات قابلية الذوبان في توافق مع الحياة والمياه ويمكن استخدامها مكوك لجزيئات أصغر، ويمكن حملها على اختراق غشاء الخلية3،،من45.
لنكرناس مجموعة من الحمض النووي الريبي (> 200 nt) التي يتم نسخها من الجينوم مرناً ولكن لا يمكن ترجمتها إلى بروتينات. تزايد الأدلة أظهرت أن لنكرناس المشاركة في تنظيم التعبير الجيني6 ويشاركون في البدء والتقدم لمعظم أنواع السرطان، بما في ذلك مم7،8،9. MALAT1 نسخة فضله التخصيب النووي 2 (NEAT2) و حفظت عاليا لنكرنا10. MALAT1 معترف بها في البداية في المنتشر الخلية الصغيرة غير الرئة السرطان (NSCLC)11، ولكن قد تم overexpressed في عدة أورام5،،من1213؛ هو واحد من لنكرناس أعرب عن أشد ويرتبط مع سوء تشخيص في مم8،14. مستوى التعبير MALAT1 أعلى بكثير في دورة فادح extramedullary مم المرضى مقارنة بتلك التي شخصت فقط ملم15.
في دراسة سابقة، وقد أكدنا أن أوليجوس MALAT1 مكافحة قوة تؤدي إلى تلف الحمض النووي والمبرمج في مم16 باستخدام الحمض النووي جابمير النوكليوتيد العقاقير تستهدف MALAT1 (مكافحة-MALAT1) في الخلايا ملم. الحمض النووي جابمير تتألف من الحمض النووي العقاقير وربط 2 ‘–OMe-الكشف، الذي يمكن أن يدفع الانقسام MALAT1 ب النشاط مرة ملزمة”رناسي ح”17. لا تزال حدود كفاءة المجراة في تسليم العقاقير أوليجوس في الاستخدام السريري.
لاختبار أداء فونكتيوناليزيد أثر سوكنت لمكافحة MALAT1 جابمير أوليجوس، جابمير MALAT1 المضادة هو مترافق الحمض النووي إلى دسبي-PEG2000-أمين سوكنت. ثم يتم حقن سوكنت-ضد-MALAT1 عن طريق الوريد في نموذج نشر ماوس مم؛ ويلاحظ تثبيط ملفتة للنظر بعد أربعة علاجات.
وتبين الأدلة أن لنكرناس المشاركة في تنظيم العديد من إجراءات الفسيولوجية والفيزيولوجية المرضية في حالات السرطان، بما في ذلك مم7،،من89؛ لديهم القدرة على أن تكون هدفا لعلاج السرطان، التي يمكن أن تتحقق بالعقاقير النوكليوتيد20<sup…
The authors have nothing to disclose.
يشكر المؤلفون بمعهد أبحاث ليرنر البروتين، الجينوم، وأساسيات التصوير لما قدمته من المساعدة ودعم. التمويل: كان يؤيد هذا العمل ماليا بالمعاهد الوطنية للصحة/NCI منحة R00 CA172292 (J.J.Z.) وأموال بدء التشغيل (ل J.J.Z.) والسريرية ومتعدية العلوم التعاونية (كتس) قضية Western Reserve جامعة الأساسية استخدام الطيار غرانت (إلى J.J.Z.). هذا العمل استخدام المجهر SP8 إيكا [كنفوكل] التي تم شراؤها بتمويل من “المعاهد الوطنية للصحة سيج” المنح 1S10OD019972-01.
SWCNTs | Millipore-Sigma | 704113 | |
DSPE-PEG2000-Amine | Avanti Polar Lipids | 880128 | |
bath sonicator | VWR | 97043-992 | |
4 mL centrifugal filter | Millipore-Sigma | Z740208-8EA | |
UV/VIS spectrometer | Thermo Fisher Scientific | accuSkan GO UV/Vis Microplate Spectrophotometer | extinction coefficient of 0.0465 L/mg/cm at 808 nm |
Sulfo-LC-SPDP | ProteoChem | c1118 | |
DTT solution | Millipore-Sigma | 43815 | |
NAP-5 column | GE Healthcare | 17-0853-01 | |
in vivo imaging system | PerkinElmer | ||
NOD.CB17-Prkdcscid/J mice | Charles River lab | 250 | |
Flow cytometer | Becton Dickinso | ||
Lipofectamine | Invitrogen | 11668019 | Lipofectamine2000 |
Fetal bovine serum (FBS) | Invitrogen | 10437-028 | |
RMPI-1640 medium | Invitrogen | 11875-093 | |
MALAT1-QF: | synthesized by IDT Company | 5’- GTTCTGATCCCGCTGCTATT – 3’ | |
MALAT1-QR: | synthesized by IDT Company | 5’- TCCTCAACACTCAGCCTTTATC – 3’ | |
GAPDH-QF: | synthesized by IDT Company | 5’- CAAGAGCACAAGAGGAAGAGAG – 3’ | |
GAPDH-QR: | synthesized by IDT Company | 5’- CTACATGGCAACTGTGAGGAG – 3’ | |
Quantitative PCR using SYBR Green PCR master mix | Thermo Fisher Scientific | A25780 | |
RevertAid first-stand cDNA synthesis kit | Thermo Fisher Scientific | K1621 | |
anti-MALAT1 | synthesized by IDT Company | 5’-mC*mG*mA*mA*mA*C*A*T*T *G*G*C*A*C*A*mC*mA*mG*mC*mA-3’ |
|
Cell Viability Assay Kit | Promega Corporation | G7570 | CellTiter-GloLuminescent Cell Viability Assay Kit |
accuSkan GO UV/Vis Microplate Spectrophotometer | Thermo Fisher Scientific | ||
centrifugal filter | Millipore-Sigma | UFC910008 | |
SPSS software | IBM | version 24.0 | |
D-Luciferin | Millipore-Sigma | L9504 |