이 원고는 단일 벽 탄소 나노튜브 (SWCNT)의 합성에 설명 합니다-는 SWCNT의 안정적인 납품과의 강력한 치료 효과 보여 주는 MALAT1 센스 gapmer DNA oligonucleotide (SWCNT-안티-MALAT1) 활용 안티-MALAT1 생체 외에서 그리고 vivo. 합성, 수정, 활용, 사용 하는 방법 그리고 주입 SWCNT-안티-MALAT1의 설명.
단일 벽 탄소 나노튜브 (SWCNT)는 새로운 유형의 나노, 세포, 단백질, oligonucleotides, 합성 작은 분자 약물 등으로 약의 여러 종류를 제공 하는 데 사용 되었습니다. SWCNT 사용자 정의 크기, 큰 표면 영역 있고 유연 하 게 표면;에 다른 수정 마약으로 바인딩할 수 있습니다. 따라서, 셀으로 마약을 수송 하는 이상적인 시스템 이다. 긴 noncoding RNAs (lncRNAs)는 200 이상 noncoding RNA의 클러스터 nt는 단백질에 번역 될 수 없습니다 하지만 생물 학적 및 병 태 생리 과정에 중요 한 역할. 전이 관련 된 폐 선 암 사본 1 (MALAT1)은 매우 보존된 lncRNA 이다. 그것은 상부 MALAT1 여러 발성 (MM)를 포함 한 다양 한 암에서의 빈약한 예 지에 관련 된 시연 했다. 우리 MALAT1 mm; DNA 수리 및 세포 죽음 통제 밝혀졌다 따라서, MALAT1 m M에 대 한 치료 대상으로 간주 될 수 있습니다. 그러나, 센스 oligo의 억제/최저 MALAT1 vivo에서 효율적인 배달 여전히 문제입니다. 이 연구에서 우리 못 2000 SWCNT 수정 그것에 안티 MALAT1 올리고 켤레, 테스트 생체 외에서 화합물의 배달, 전파 m M 마우스 모델, 정 맥 주입 하 고 나타내는 m M 진행의 중요 한 금지를 관찰 그 SWCNT 안티 MALAT1 gapmer DNA에 대 한 이상적인 배달 셔틀 이다.
SWCNT 소설을 접한 제공할 수 있는 다양 한 유형의 약물, 단백질, 작은 분자, 핵 산 등 안정적이 고 효율적으로 이상적인 tolerability와 시험관1 에 vivo에서2최소 독성입니다. 기능성된 SWCNT 좋은 생체 적합성 및 물 가용성, 작은 분자에 대 한 셔틀으로 사용 될 수 있으며 세포 막3,,45에 침투 하는 그들을 가져올 수 있다.
lncRNAs는 RNA의 클러스터 (> 200 nt) 게놈에서 mRNA를 복사할 수는 있지만 단백질에 번역 될 수 없습니다. LncRNAs 유전자 식6 의 규칙에 참여 하 고 개시와 대부분의 유형의 암, m M7,8,9등의 진행에 관련 된 증거를 증가 보이고 있다. MALAT1 핵 농축 noncoding 사본을 2 (NEAT2)은 매우 보존된 lncRNA10. MALAT1 전이성 비 작은 세포 폐 암 (NSCLC)11, 처음 인식 하지만 수많은 종양5,,1213;에 overexpressed 되었습니다. 그것은 가장 높은 표현된 lncRNAs 중 하나 이며 m M8,14에서 가난한 예 후와 상관 된다. MALAT1 식 수준 치명적인 코스 extramedullary m M 환자 m M15로 진단만 그에 비해 크게 높은 수준 이다.
이전 연구에서 우리는 안티-MALAT1 oligos 튼튼하게 이어질 DNA 손상 및 m M16 에서 apoptosis gapmer DNA 센스 oligonucleotides MALAT1 타겟팅을 사용 하 여 확인 했습니다 (안티-MALAT1) MM 셀에서. Gapmer DNA 센스 DNA의 구성 이며 2′-오메-RNAs, RNase H 한 번 바운드 활동17여 MALAT1 분열을 프롬프트 수 있는 연결. 센스 oligos의 생체 조건 납품 효율성은 아직도 그것의 임상 사용을 제한합니다.
배달 테스트 안티 MALAT1 gapmer oligos, DNA DSPE-PEG2000-아민에 활용 된 안티 MALAT1 gapmer에 대 한 SWCNT의 효과 기능성 SWCNT. SWCNT 안티 MALAT1 다음 주입 정 맥 MM 전파 마우스 모델; 눈에 띄는 억제 4 치료 후 관찰 됩니다.
LncRNAs m M7,,89;를 포함 하 여 암에 수많은 생리 및 병 태 생리 절차의 규칙에 참여를 보이고 있다는 증거 그들은 센스 oligonucleotides20,,2122에 의해 실현 될 수 있는 암 치료에 대 한 타겟이 될 가능성이 있다. 미국 식품 및 의약품 안전 청 (FDA)는 세포 망막<sup class…
The authors have nothing to disclose.
저자 러너 연구소 proteomic, 게놈, 및 그들의 지원에 대 한 이미징 코어를 감사 하 고 지원 합니다. 자금:이 작품 NIH/NCI 부여 R00 CA172292 (J.J.Z.) (J.J.Z.)을 창업 자금 및 임상 및 변환 과학 공동 (CTSC) 케이스 서쪽 예비 대학 코어 사용률 파일럿 부여 (J.J.Z.)의 의해 재정적으로 지원 되었다. 이 작품 활용 건강 SIG의 국가 학회 교부 금 1S10OD019972-01 자금 구입 했던 Leica SP8 confocal 현미경.
SWCNTs | Millipore-Sigma | 704113 | |
DSPE-PEG2000-Amine | Avanti Polar Lipids | 880128 | |
bath sonicator | VWR | 97043-992 | |
4 mL centrifugal filter | Millipore-Sigma | Z740208-8EA | |
UV/VIS spectrometer | Thermo Fisher Scientific | accuSkan GO UV/Vis Microplate Spectrophotometer | extinction coefficient of 0.0465 L/mg/cm at 808 nm |
Sulfo-LC-SPDP | ProteoChem | c1118 | |
DTT solution | Millipore-Sigma | 43815 | |
NAP-5 column | GE Healthcare | 17-0853-01 | |
in vivo imaging system | PerkinElmer | ||
NOD.CB17-Prkdcscid/J mice | Charles River lab | 250 | |
Flow cytometer | Becton Dickinso | ||
Lipofectamine | Invitrogen | 11668019 | Lipofectamine2000 |
Fetal bovine serum (FBS) | Invitrogen | 10437-028 | |
RMPI-1640 medium | Invitrogen | 11875-093 | |
MALAT1-QF: | synthesized by IDT Company | 5’- GTTCTGATCCCGCTGCTATT – 3’ | |
MALAT1-QR: | synthesized by IDT Company | 5’- TCCTCAACACTCAGCCTTTATC – 3’ | |
GAPDH-QF: | synthesized by IDT Company | 5’- CAAGAGCACAAGAGGAAGAGAG – 3’ | |
GAPDH-QR: | synthesized by IDT Company | 5’- CTACATGGCAACTGTGAGGAG – 3’ | |
Quantitative PCR using SYBR Green PCR master mix | Thermo Fisher Scientific | A25780 | |
RevertAid first-stand cDNA synthesis kit | Thermo Fisher Scientific | K1621 | |
anti-MALAT1 | synthesized by IDT Company | 5’-mC*mG*mA*mA*mA*C*A*T*T *G*G*C*A*C*A*mC*mA*mG*mC*mA-3’ |
|
Cell Viability Assay Kit | Promega Corporation | G7570 | CellTiter-GloLuminescent Cell Viability Assay Kit |
accuSkan GO UV/Vis Microplate Spectrophotometer | Thermo Fisher Scientific | ||
centrifugal filter | Millipore-Sigma | UFC910008 | |
SPSS software | IBM | version 24.0 | |
D-Luciferin | Millipore-Sigma | L9504 |