Ce manuscrit décrit la synthèse d’un nanotube de carbone monoparoi (NCM)-conjugué MALAT1 gapmer antisens ADN d’oligonucléotide (SWCNT-anti-MALAT1), qui montre la remise fiable du NCM et le puissant effet thérapeutique de anti-MALAT1 in vitro et in vivo. Méthodes utilisées pour la synthèse, de modification, de conjugaison, et injection de SWCNT-anti-MALAT1 sont décrites.
Le nanotube de carbone monoparoi (NCM) est un nouveau type de nanoparticules, qui a été utilisé pour livrer plusieurs sortes de drogues dans les cellules, tels que des protéines, des oligonucléotides et médicaments à petites molécules synthétiques. Le NCM a dimensions personnalisables, une vaste zone superficielle et peut se lier avec souplesse avec des médicaments par le biais de différentes modifications sur sa surface ; par conséquent, c’est un système idéal pour transporter les médicaments dans les cellules. ARN long non codantes (lncRNAs) est un amas d’ARN non codant plu de 200 nt, qui ne peut pas être traduit en protéine, mais joue un rôle important dans les processus biologiques et physiopathologiques. Associées aux métastases pulmonaires adénocarcinome transcription 1 (MALAT1) est une lncRNA hautement conservée. Il a été démontré que des niveaux plus élevés de MALAT1 concernent le mauvais pronostic de divers cancers, notamment le myélome multiple (MM). Nous avons révélé que MALAT1 régule l’ADN réparation et la mort cellulaire en MM ; ainsi, MALAT1 peut être considéré comme une cible thérapeutique pour MM. Cependant, l’efficience de l’oligo antisens pour inhiber/knockdown MALAT1 in vivo est toujours un problème. Dans cette étude, nous modifier le NCM avec PEG-2000 et conjugué un oligo anti-MALAT1 à elle, tester la livraison de ce composé in vitro, injecter par voie intraveineuse dans un modèle de souris MM disséminé et observer une inhibition significative de la progression de MM, ce qui indique cette SWCNT est une navette de livraison idéal pour anti-MALAT1 gapmer ADN.
Le NCM est un nanomatériau roman qui peut fournir différents types de médicaments, comme les acides nucléiques, protéines et petites molécules stablement et efficacement avec la tolérabilité idéale et toxicité minimale1 de la vitro et in vivo2. Un SWCNT fonctionnalisé a grande solubilité de biocompatibilité et de l’eau, peut être utilisé comme un service de navette pour les molécules plus petites et peut transporter pour pénétrer la membrane de la cellule3,4,5.
lncRNAs sont un amas d’ARN (> 200 nt) qui sont transcrits à partir du génome à l’ARNm, mais ne peut pas être traduit en protéines. Augmentant la preuve a démontré que les lncRNAs participent à la régulation de l’ expression de gène6 et sont impliqués dans l’apparition et la progression de la plupart des types de cancer, y compris MM7,8,9. MALAT1 est une transcription non codante nucléaire enrichi 2 (NEAT2) et un lncRNA hautement conservée10. MALAT1 est initialement reconnu métastatique pulmonaire non à petites cellules (NSCLC) le cancer11, mais a été surexprimé dans nombreuses tumeurs5,12,13; Il est l’un de le lncRNAs plus fortement exprimée et est corrélé à un mauvais pronostic en MM8,14. Le niveau d’expression de MALAT1 est significativement plus élevé chez les cours fatal extramédullaire MM par rapport à ceux diagnostiqués uniquement sous la forme MM15.
Dans une étude précédente, nous avons confirmé qu’anti-MALAT1 oligos conduire fermement pour dommages à l’ADN et l’apoptose dans MM16 en utilisant des oligonucléotides antisens d’ADN gapmer ciblage MALAT1 (anti-MALAT1) dans les cellules MM. L’ADN de gapmer est composé d’ADN antisens et relié par 2′-OMe-ARN, qui pourrait inciter un clivage MALAT1 par la RNase H activité liée une fois17. L’efficacité de livraison in vivo des oligonucléotides antisens limite toujours son utilisation clinique.
Pour tester la livraison effet de SWCNT pour anti-MALAT1 gapmer oligos, l’anti-MALAT1 gapmer ADN est conjugué à la DSPE-PEG2000-amine fonctionnalisés NCM. Le NCM-anti-MALAT1 est ensuite injectée par voie intraveineuse dans un modèle de souris disséminée MM ; On observe une inhibition frappante après quatre traitements.
Preuve a démontré que les lncRNAs participent à la régulation de nombreuses procédures physiologiques et physiopathologiques dans les cancers, y compris MM7,8,9; Ils ont le potentiel d’être la cible pour le traitement du cancer, qui peut être réalisé par oligonucléotides antisens20,21,22. La U.S. Food and la Drug Administrat…
The authors have nothing to disclose.
Les auteurs remercient l’Institut de recherche Lerner de protéomique, génomique et carottes d’imagerie pour leur aide et soutien. Financement : Ce travail a été soutenu financièrement par subvention de NIH/NCI R00 CA172292 (pour J.J.Z.) et fonds d’amorçage (à J.J.Z.) et la clinique et translationnelle Science Collaborative (CNTC) de la Case Western Reserve University Core utilisation pilote Grant (à J.J.Z.). Ce travail a utilisé le microscope confocal Leica SP8 qui a été acheté grâce à un financement des instituts nationaux de santé SIG grant 1S10OD019972-01.
SWCNTs | Millipore-Sigma | 704113 | |
DSPE-PEG2000-Amine | Avanti Polar Lipids | 880128 | |
bath sonicator | VWR | 97043-992 | |
4 mL centrifugal filter | Millipore-Sigma | Z740208-8EA | |
UV/VIS spectrometer | Thermo Fisher Scientific | accuSkan GO UV/Vis Microplate Spectrophotometer | extinction coefficient of 0.0465 L/mg/cm at 808 nm |
Sulfo-LC-SPDP | ProteoChem | c1118 | |
DTT solution | Millipore-Sigma | 43815 | |
NAP-5 column | GE Healthcare | 17-0853-01 | |
in vivo imaging system | PerkinElmer | ||
NOD.CB17-Prkdcscid/J mice | Charles River lab | 250 | |
Flow cytometer | Becton Dickinso | ||
Lipofectamine | Invitrogen | 11668019 | Lipofectamine2000 |
Fetal bovine serum (FBS) | Invitrogen | 10437-028 | |
RMPI-1640 medium | Invitrogen | 11875-093 | |
MALAT1-QF: | synthesized by IDT Company | 5’- GTTCTGATCCCGCTGCTATT – 3’ | |
MALAT1-QR: | synthesized by IDT Company | 5’- TCCTCAACACTCAGCCTTTATC – 3’ | |
GAPDH-QF: | synthesized by IDT Company | 5’- CAAGAGCACAAGAGGAAGAGAG – 3’ | |
GAPDH-QR: | synthesized by IDT Company | 5’- CTACATGGCAACTGTGAGGAG – 3’ | |
Quantitative PCR using SYBR Green PCR master mix | Thermo Fisher Scientific | A25780 | |
RevertAid first-stand cDNA synthesis kit | Thermo Fisher Scientific | K1621 | |
anti-MALAT1 | synthesized by IDT Company | 5’-mC*mG*mA*mA*mA*C*A*T*T *G*G*C*A*C*A*mC*mA*mG*mC*mA-3’ |
|
Cell Viability Assay Kit | Promega Corporation | G7570 | CellTiter-GloLuminescent Cell Viability Assay Kit |
accuSkan GO UV/Vis Microplate Spectrophotometer | Thermo Fisher Scientific | ||
centrifugal filter | Millipore-Sigma | UFC910008 | |
SPSS software | IBM | version 24.0 | |
D-Luciferin | Millipore-Sigma | L9504 |