כתב יד זה מתאר את הסינתזה של ננו-צינורית פחמן קיר אחד (SWCNT)-מצומדת MALAT1 antisense gapmer דנ א oligonucleotide (SWCNT-נגד-MALAT1), אשר מדגים מסירת SWCNT אמין, חזק טיפולית והשפעת anti-MALAT1 במבחנה, ויוו. שיטות להשתמש של סינתזה, שינוי, ההטיה, הזרקה של SWCNT-נגד-MALAT1 מתוארים.
ננו-צינורית פחמן קיר אחד (SWCNT) הוא סוג חדש של ננו-חלקיק, אשר שימש כדי לספק מספר סוגי סמים לתוך תאים, כגון חלבונים, oligonucleotides, תרופות סינתטיות מולקולה קטנה. SWCNT המימדים הניתנות להתאמה אישית, שטחי אזור גדול, באפשרותך לאגוד בגמישות עם סמים דרך שינויים שונים על פני השטח שלו; לכן, זה מערכת אידיאלי להעברת סמים לתוך התאים. זמן noncoding RNAs (lncRNAs) הם מקבץ של יותר מ 200 noncoding RNA nt, אשר לא יכול להיות מתורגם לחלבון אבל יש תפקיד חשוב בתהליכים ביולוגיים, הקשורים pathophysiological. גרורות-הקשורים ריאות אדנוקרצינומה התעתיק 1 (MALAT1) הוא lncRNA שנשמרת מאוד. הוכח כי רמות MALAT1 גבוהות קשורות על פרוגנוזה גרועה סוגי סרטן שונים, לרבות מיאלומה נפוצה (מ מ). נחשפו MALAT1 מווסת את תיקון ה-DNA ומוות תא מ מ; לפיכך, MALAT1 יכול להיחשב מטרה טיפולית עבור מ מ. עם זאת, oligo antisense מסירת יעיל כדי לעכב/נוקאאוט MALAT1 ויוו היא עדיין בעיה. במחקר זה, לנו לשנות את SWCNT עם פג-2000 ו נזווג oligo anti-MALAT1 אליו לבדוק את המשלוח של מתחם זה במבחנה, תזריק את זה דרך הווריד למודל בעכבר של מ מ המופץ, להתבונן על עיכוב משמעותי של התקדמות מ מ, אשר מציינת SWCNT הזה הוא הסעה משלוח אידיאלי עבור gapmer אנטי-MALAT1 ה-DNA.
SWCNT הוא nanomaterial חדשניים שיכולים לספק סוגים שונים של תרופות, כגון חלבונים, מולקולות קטנות, חומצות גרעין, stably וביעילות עם סבילות אידיאלי, רעילות מינימלית חוץ גופית1 וויוו2. SWCNT functionalized יש נהדר מסיסות הביו ומים, יכול לשמש הסעות עבור מולקולות קטנות יותר, והוא מסוגל לשאת להן לחדור את קרום התא3,4,5.
lncRNAs הם מקבץ של RNA (> 200 nt) זה משוקלטים מן הגנום ל mRNA אבל לא ניתן היה לתרגם את החלבונים. הוכחה גוברת הראו כי lncRNAs להשתתף ברגולציה של ביטוי גנים6 , מעורבים החניכה, התקדמות של רוב סוגי סרטן, כולל מ מ7,8,9. MALAT1 הוא תעתיק noncoding גרעיני מועשר 2 (NEAT2), מאוד שנשמרת lncRNA10. MALAT1 מזוהה בתחילה ריאות שאינם קטנים התא גרורתית סרטן (NSCLC)11, אבל יש כבר overexpressed רבים גידולים5,12,13; הוא נחשב לאחד lncRNAs ביטוי ביותר, הוא מתואם עם פרוגנוזה גרועה מ מ8,14. רמת הביטוי של MALAT1 גבוה משמעותית בחולים קורס קטלני extramedullary מ”מ לעומת אלו שאובחנו רק מ מ15.
במחקר הקודם, יש לנו אישר כי אנטי-MALAT1 oligos robustly לגרום נזק לדנ א אפופטוזיס מ מ16 באמצעות gapmer DNA antisense oligonucleotides מיקוד MALAT1 (אנטי-MALAT1) בתאים מ מ. ה-DNA gapmer המורכב antisense DNA, מקושרים על ידי 2′-הביתה-RNAs, אשר יכול לבקש MALAT1 המחשוף מאת RNase H פעילות פעם מאוגד17. יעילות משלוח ויוו antisense oligos עדיין מגבילה את השימוש הקליני.
כדי לבדוק את המשלוח אפקט של SWCNT אנטי-MALAT1 gapmer oligos, gapmer אנטי-MALAT1 ה-DNA היא מצומדת כדי DSPE-PEG2000-אמין functionalized SWCNT. SWCNT-נגד-MALAT1 מכן מוזרק לווריד מודל העכבר המופץ מ מ; עיכוב בולט הוא ציין לאחר ארבעה טיפולים.
הראיות הוכיחו כי lncRNAs לקחת חלק מרכזי בויסות פיזיולוגיים רבים ושגרות pathophysiological ב סרטן, כולל7,מ מ8,9; יש להם פוטנציאל להיות ממוקד לטיפול בסרטן, אשר יכול להתממש מאת antisense oligonucleotides20,21,22. המזון ו?…
The authors have nothing to disclose.
המחברים תודה את המכון לחקר לרנר פרוטיאומיה מבנית, גנומית, ואת ההדמיה ליבות לסיוע שלהם ותמיכה. מימון: עבודה זו נתמכה כלכלית על ידי NIH/NCI מענק R00 CA172292 (J.J.Z.) ואת ראשונית (ל J.J.Z.) ואת קלינית Translational המדע שיתופית (CTSC) של התיק Western Reserve אוניברסיטת הליבה ניצול טייס גרנט (ל J.J.Z.). עבודה זו מנוצל מיקרוסקופ קונפוקלי SP8 לייקה אשר נרכש עם מימון מוסדות לאומיים של בריאות סיג גרנט 1S10OD019972-01.
SWCNTs | Millipore-Sigma | 704113 | |
DSPE-PEG2000-Amine | Avanti Polar Lipids | 880128 | |
bath sonicator | VWR | 97043-992 | |
4 mL centrifugal filter | Millipore-Sigma | Z740208-8EA | |
UV/VIS spectrometer | Thermo Fisher Scientific | accuSkan GO UV/Vis Microplate Spectrophotometer | extinction coefficient of 0.0465 L/mg/cm at 808 nm |
Sulfo-LC-SPDP | ProteoChem | c1118 | |
DTT solution | Millipore-Sigma | 43815 | |
NAP-5 column | GE Healthcare | 17-0853-01 | |
in vivo imaging system | PerkinElmer | ||
NOD.CB17-Prkdcscid/J mice | Charles River lab | 250 | |
Flow cytometer | Becton Dickinso | ||
Lipofectamine | Invitrogen | 11668019 | Lipofectamine2000 |
Fetal bovine serum (FBS) | Invitrogen | 10437-028 | |
RMPI-1640 medium | Invitrogen | 11875-093 | |
MALAT1-QF: | synthesized by IDT Company | 5’- GTTCTGATCCCGCTGCTATT – 3’ | |
MALAT1-QR: | synthesized by IDT Company | 5’- TCCTCAACACTCAGCCTTTATC – 3’ | |
GAPDH-QF: | synthesized by IDT Company | 5’- CAAGAGCACAAGAGGAAGAGAG – 3’ | |
GAPDH-QR: | synthesized by IDT Company | 5’- CTACATGGCAACTGTGAGGAG – 3’ | |
Quantitative PCR using SYBR Green PCR master mix | Thermo Fisher Scientific | A25780 | |
RevertAid first-stand cDNA synthesis kit | Thermo Fisher Scientific | K1621 | |
anti-MALAT1 | synthesized by IDT Company | 5’-mC*mG*mA*mA*mA*C*A*T*T *G*G*C*A*C*A*mC*mA*mG*mC*mA-3’ |
|
Cell Viability Assay Kit | Promega Corporation | G7570 | CellTiter-GloLuminescent Cell Viability Assay Kit |
accuSkan GO UV/Vis Microplate Spectrophotometer | Thermo Fisher Scientific | ||
centrifugal filter | Millipore-Sigma | UFC910008 | |
SPSS software | IBM | version 24.0 | |
D-Luciferin | Millipore-Sigma | L9504 |