Dit manuscript beschrijft de synthese van een single-muur koolstof nanobuis (SWCNT)-geconjugeerd MALAT1 antisense gapmer DNA oligonucleotide (SWCNT-anti-MALAT1), waaruit blijkt hoe de betrouwbare levering van de SWCNT en het krachtige therapeutische effect van anti-MALAT1 in vitro en in vivo. Methoden voor synthese, wijziging, conjugatie, en injectie van SWCNT-anti-MALAT1 worden beschreven.
De single-muur koolstof nanobuis (SWCNT) is een nieuw soort nanoparticle, die is gebruikt voor het leveren van meerdere soorten drugs in cellen, zoals eiwitten, oligonucleotides en synthetische drugs van de kleine-molecuul. De SWCNT heeft van aanpasbare afmetingen, een groot oppervlakkige gebied, en flexibel kunt binden met drugs door verschillende wijzigingen op het oppervlak; Daarom is het een ideaal systeem voor het vervoer van drugs in cellen. Lang noncoding RNAs (lncRNAs) zijn een cluster van noncoding RNA langer dan 200 nt, die niet kan worden vertaald naar eiwit, maar een belangrijke rol spelen in de biologische en pathofysiologische processen. Metastase-geassocieerde Long adenocarcinoom transcript 1 (MALAT1) is een zeer geconserveerde lncRNA. Het bleek dat hogere MALAT1 niveaus zijn gerelateerd aan de slechte prognose van verschillende soorten kanker, met inbegrip van multipel myeloom (MM). We hebben aangetoond dat MALAT1 DNA-reparatie en cel dood in MM regelt; MALAT1 kan dus worden beschouwd als een therapeutisch doel voor MM. De efficiënte levering van de antisense oligo aan remmen/knockdown MALAT1 in vivo is echter nog steeds een probleem. In deze studie, wij wijzigen de SWCNT met PEG-2000 en conjugaat van een anti-MALAT1-oligo ernaar, de levering van dit samengestelde in vitro testen, het intraveneus te injecteren in een gedissemineerde muismodel van MM en observeren een significante remming van MM progressie, waarmee wordt aangegeven dat SWCNT is een ideale levering shuttle voor anti-MALAT1 gapmer DNA.
De SWCNT is een roman nanomateriaal die met ideale verdraagbaarheid en minimale toxiciteit in vitro1 en in vivo2verschillende soorten drugs, zoals proteïnen, kleine molecules en nucleïnezuren, stabiel en efficiënt kan leveren. Een functionalized SWCNT grote biocompatibiliteit en water oplosbaarheid heeft, kan worden gebruikt als een shuttle voor kleinere moleculen en kan ze doordringen in het celmembraan3,4,5.
lncRNAs zijn een cluster van RNA (> 200 nt) dat van het genoom zijn herschreven als mRNA maar kan niet worden omgezet in eiwitten. Een groeiende hoeveelheid bewijs heeft aangetoond dat lncRNAs deelnemen aan de regulering van gen expressie6 en betrokken bij de inleiding en de progressie van de meeste vormen van kanker zijn, met inbegrip van MM7,8,9. MALAT1 is een nucleaire verrijkte noncoding transcript 2 (NEAT2) en een zeer geconserveerde lncRNA10. MALAT1 is in eerste instantie erkend in uitgezaaide niet-kleincellige longkanker kanker (NKCLK)11, maar heeft zijn overexpressie in talrijke tumoren5,12,,13; het is een van de meest uitgesproken lncRNAs en is gecorreleerd met een slechte prognose in MM8,14. Het niveau van de expressie van het MALAT1 is aanzienlijk hoger bij fatale cursus extramedullary MM patiënten vergeleken met die alleen gediagnosticeerd als MM15.
In een eerdere studie, wij hebben bevestigd dat oligos van de anti-MALAT1 krachtig tot DNA-beschadiging en apoptosis in MM16 leiden met behulp van gapmer DNA antisense oligonucleotides gericht op MALAT1 (anti-MALAT1) in MM cellen. Het gapmer-DNA is samengesteld uit antisense DNA en verbonden door 2′-OMe-RNAs, die kon MALAT1 decollete gevraagd door RNase H activiteit eenmaal gebonden17. De efficiëntie van de in vivo levering van antisense oligos beperkt nog steeds haar klinische gebruik.
Als u wilt testen de levering matiemaatschappij effect van SWCNT voor anti-MALAT1 gapmer oligos, de anti-MALAT1-gapmer DNA is geconjugeerd met DSPE-PEG2000-amine SWCNT. De SWCNT-anti-MALAT1 wordt daarna intraveneus geïnjecteerd in een gedissemineerde muismodel van MM; een opvallende remming wordt waargenomen na vier behandelingen.
Bewijs heeft aangetoond dat lncRNAs deelnemen aan de regeling van verschillende fysiologische en pathofysiologische procedures in kanker, met inbegrip van MM7,8,9; ze hebben het potentieel om voor de behandeling van kanker, die kan worden gerealiseerd door antisense oligonucleotides20,21,22worden gericht. De Amerikaanse Food and Drug Ad…
The authors have nothing to disclose.
De auteurs bedanken de Lerner Research Institute proteomic, genomic, en imaging kernen voor hun hulp en steun. Financiering: Dit werk werd financieel ondersteund door de NIH/NCI subsidie R00 CA172292 (J.J.Z.) en start-up middelen (J.J.Z.) en de klinisch en translationeel wetenschap Collaborative (CTSC) van de Case Western Reserve University Core gebruik Pilot subsidie (J.J.Z.). Dit werk gebruikt de Leica SP8 confocal microscoop die is gekocht met financiële steun van de nationale instituten van gezondheid SIG verlenen 1S10OD019972-01.
SWCNTs | Millipore-Sigma | 704113 | |
DSPE-PEG2000-Amine | Avanti Polar Lipids | 880128 | |
bath sonicator | VWR | 97043-992 | |
4 mL centrifugal filter | Millipore-Sigma | Z740208-8EA | |
UV/VIS spectrometer | Thermo Fisher Scientific | accuSkan GO UV/Vis Microplate Spectrophotometer | extinction coefficient of 0.0465 L/mg/cm at 808 nm |
Sulfo-LC-SPDP | ProteoChem | c1118 | |
DTT solution | Millipore-Sigma | 43815 | |
NAP-5 column | GE Healthcare | 17-0853-01 | |
in vivo imaging system | PerkinElmer | ||
NOD.CB17-Prkdcscid/J mice | Charles River lab | 250 | |
Flow cytometer | Becton Dickinso | ||
Lipofectamine | Invitrogen | 11668019 | Lipofectamine2000 |
Fetal bovine serum (FBS) | Invitrogen | 10437-028 | |
RMPI-1640 medium | Invitrogen | 11875-093 | |
MALAT1-QF: | synthesized by IDT Company | 5’- GTTCTGATCCCGCTGCTATT – 3’ | |
MALAT1-QR: | synthesized by IDT Company | 5’- TCCTCAACACTCAGCCTTTATC – 3’ | |
GAPDH-QF: | synthesized by IDT Company | 5’- CAAGAGCACAAGAGGAAGAGAG – 3’ | |
GAPDH-QR: | synthesized by IDT Company | 5’- CTACATGGCAACTGTGAGGAG – 3’ | |
Quantitative PCR using SYBR Green PCR master mix | Thermo Fisher Scientific | A25780 | |
RevertAid first-stand cDNA synthesis kit | Thermo Fisher Scientific | K1621 | |
anti-MALAT1 | synthesized by IDT Company | 5’-mC*mG*mA*mA*mA*C*A*T*T *G*G*C*A*C*A*mC*mA*mG*mC*mA-3’ |
|
Cell Viability Assay Kit | Promega Corporation | G7570 | CellTiter-GloLuminescent Cell Viability Assay Kit |
accuSkan GO UV/Vis Microplate Spectrophotometer | Thermo Fisher Scientific | ||
centrifugal filter | Millipore-Sigma | UFC910008 | |
SPSS software | IBM | version 24.0 | |
D-Luciferin | Millipore-Sigma | L9504 |