다양 한 센스 oligonucleotides (AONs) exon 포함 (스플라이스 변조) 유도 및 SMN 식 척수 근육 위축 증 (SMA)에 대 한 구조를 보였다. 여기, 우리는 SMN2 유전자와 SMA 환자의 섬유 아 세포에서 효능을 결정 하는 평가 방법에 exon 포함 유도 하 이온 lipotransfection에 대 한 프로토콜을 설명 합니다.
척수 근육 위축 증 (SMA), SMN1의 손실에 의해 발생 하는 치명적인 신경 질환 선물 센스 oligonucleotide (이온)의 분야에서 독특한 케이스-치료 중재. SMN1 돌연변이 질병에 대 한 책임, AONs SMN2에 intronic 스플라이스 소음 (ISS) 사이트를 대상으로 FDA 승인 nusinersen를 포함 하 여 보였다 SMN 식 복원 하 고 증상을 개선 하. 현재, SMA를 위한 이온 치료를 포함 하는 많은 연구 조사 SMN2 nusinersen 보다 더 효과적이 고 덜 독성 수 있는 대상으로 하는 소설 이온 화학에 초점. 여기, 우리는 exon 포함 AONs 반전 녹음 방송 연쇄 반응 (RT-PCR), 정량적 중 합 효소 연쇄 반응 (정량), 및 서쪽에 게 더 럽 히기의 lipotransfection를 사용 하 여 체 외에서 평가 대 한 프로토콜을 설명 합니다. 이 메서드는 다양 한 이온 화학에 대 한 사용할 수 있습니다. 우리 AONs 번갈아 잠긴된 핵 산 (Lna)의 구성 및 DNA 뉴클레오티드 (LNA/DNA mixmers) 효율적인 SMN2 exon 포함 및 매우 낮은 농도, 그리고 그러므로, LNA에서 SMN 단백질의 복원으로 이어질 입증이 메서드를 사용 하 여 / DNA mixmer 기반 센스 oligonucleotides 유전자 질병으로 인 한 접합 결함을 치료 하는 매력적인 치료 전략을 수 있습니다. 생체 외에서 평가 여기 설명 된 방법은 빠르고, 쉽고, 충분히 다양 한 소설 AONs의 테스트에 대 한 민감한입니다.
척수 근육 위축 증 (SMA) 상 염색체 열성 패턴에서 상속 치명적인 신경 근육 학 질환 이다. 그것은 모터 신경 및 진보적인 간선 및 사지 근육 마비1,2의 저하에 의해 특징입니다. SMA 발생의 대부분은 생존 모터 신경 1 (SMN1) 유전자3에서 homozygous 돌연변이 때문. 2 모터 뉴런의 생존 (SMN2) 유전자 SMN1의 역 중복 이며 단지 5 개의 기지4,5다른 거의 동일한 시퀀스 있다. Exon 7에에서 있는 SMN2 에서 C-T 전환 돌연변이 리드 필수 exon 7 SMN2 증명서 (그림 1a)의 거의 90%에서 제외 되 고 하기 때문에 유전자를 거의 작동으로 만든다. 단백질 제품의 불안정 하 고 급속 하 게 저하 하기 때문에 SMN2 mRNAs exon 7 누락 SMN1 함수에 대 한 보상 수 없습니다.
센스 치료는 최근 SMA6치료에 대 한 매우 유망한 전략으로 등장. 미국 식품의 약 청 (FDA)에 의해 nusinersen의 최근 승인이 했다 첫 번째 약물을 치료 SMA7에 사용할 수 있습니다. Nusinersen 2-O-methoxyethyl 수정 (모)와 phosphorothioate 등뼈는 18-메 르 센스 oligonucleotide (AON) 이다. 약물 표적 intronic 접합 소음 기 N1 (ISS-N1) intron SMN2 유전자의 7에에서 있는. ISS-N1에 nusinersen의 바인딩 exon 7 포함 (그림 1a)8,9,10 유도 기능 전체 길이 SMN 단백질 식 생 SMN2 유전자의 복구를 촉진 . 현재, SMA를 위한 이온 치료를 포함 하는 많은 연구 조사 nusinersen 보다 더 효과적이 고 덜 독성 수 있습니다 새로운 이온 화학에 초점. 그것은 다른 화학 물질과 AONs 또한 효율적으로 SMN2 exon 7에에서 exon 포함 유도 입증 되었습니다 생체 외에서 그리고 vivo에서11,,1213.
잠긴된 핵 산 (Lna) 화학적 수정된 RNA 아날로그 연결 4-탄소 2-산소 furanose 구조 (그림 1b)14,15내 methylene 다리를 포함 하는. DNAs 또는 RNAs에 비해, Lna 바인딩 보완 RNA 시퀀스에 대 한 증가 선호도 있고 생 nucleases에 저항력의 추가 이득이 있다. LNA 화학 형광에 제자리 교 잡 (물고기) 및 정량16,17조사로 사용 하기 위해 적용 되었습니다. 또한, 그것은 유전자 발현 조절에 활용 둘 다 생체 외에서 그리고 에 비보. GapmeR AONs 단일 가닥 DNA 분자 5 ‘과 3 ‘ 끝에 몇 가지 Lna에 의해 형벌의 조합입니다. 그들은 그들 활성화 RNase H18에 의해 타락을 일으키는 표적된 mRNAs를 보완 유전자 발현 바인딩에 의해 아래로 노크. LNA/DNA mixmers AONs DNA 뉴클레오티드 Lna 사이 통합의 구성입니다. 이 방향에 그들은 그것의 기능 (LNA-antimiR)19를 억제 하는 miRNA를 바인딩할 수 있습니다. 일부 LNA antimiRs 임상 개발에 도달 했습니다. 예를 들어, miravirsen (AntimiR-122) 억제 미르-122 C 형 간염 감염을 치료 하는 LNA antimiR 이며 여러 단계 II 임상 시험에는 현재 진행 중인19,20. 최근에, mixmers LNA/DNA RNA 접합21변조 또한 수 있습니다 입증 되었습니다. MRNA의 특정 시퀀스에 바인딩할 수 있고 SMN2 mRNA 생체 외에서13,22. dystrophin mRNA와 exon 포함에 건너뛰는 exon 유도
이 문서에서는, 우리는 엑손 포함 AONs 및 효능 평가 사용 하 여 RNA와 단백질 수준에서의 유도 대 한 방법론 개요. 이 방법을 예증 하 우리는 LNA/DNA mixmers SMN2의 intron 7에서에서 ISS N1을 대상으로 사용 합니다. Lipotransfection에 의해 SMA 환자의 세포로 페 AONs exon 7 포함 최종 SMN2 사본 및 SMN 단백질 생산의 upregulation에 유도. LNA/DNA mixmers를 사용 하 여 유도 exon 포함 하의 장점 중 하나는 transfection에 대 한 효과적인 농도 다른 화학13보다 훨씬 낮은입니다. 이 메서드는 phosphorodiamidate morpholino 올리고 (PMOs), 때문에 그들의 중립 책임, 엔도-포터 공동 transfection 시 약에 의해 유도 된 endocytosis 셀 입력 필요가 있는 제외한 다른 많은 AONs 위해 사용할 수 있습니다.
생체 외에서 평가 여기 설명 된 방법은 빠르고, 쉽고, 충분히 다양 한 AONs의 테스트에 대 한 민감한입니다. 이 프로토콜은 엑손 스키 핑 및 다른 유전자와 다양 한 셀 형식에 널리 적용 됩니다. 또한, 대부분 이온 화학 (PMOs)를 제외 하 고이 메서드를 사용 하 여 페 수 있습니다. AONs 타겟된 유전자를 운반 하는 플라스 미드 벡터와 공동 transfected 수 그리고 사전-mRNA에서 생 하 고 인위적으로 도입…
The authors have nothing to disclose.
저자는 실험에 대 한 니콜 McRorie 감사합니다. 이 작품은 의학 및 치과, Slipchuk SMA 연구 재단 연구 그랜트, 캐나다 연구소의 건강 연구 (CIHR), 친구의 개렛 Cumming 연구 자금, HM Toupin Neurological의 앨버타의 대학 교수에 의해 지원 되었다 과학 연구 자금, 근 위축 증 캐나다, 혁신, 앨버타 기업 및 고급 교육 및 여 성과 어린이 건강 연구소 (WCHRI)를 위한 캐나다 기초.
SMA Fibroblasts | Coriell NIGMS human genetic cell repository | GM03813 | |
Dulbecco's Modified Eagle Medium (DMEM) | Thermo Fisher | 11320033 | |
Fetal Bovine Serum | Sigma-Aldrich | F1051 | |
Penicillin-Streptomycin (10,000 U/mL) | Thermo Fisher | 15140122 | |
Trypsin-EDTA (0.05%), phenol red | Thermo Fisher | 25300062 | |
Serum-deprived media | Thermo Fisher | 31985070 | |
Transfection reagent | Thermo Fisher | 15338100 | |
guanidinium thiocyanate-phenol-chloroform (TRIzol) | Thermo Fisher | 15596-018 | |
RT-PCR Primers | Sequence 5' to 3' | ||
SMN2 forward: | CTGCCTCCATTTCCTTCTG | ||
SMN2 reverse: | TGGTGTCATTTAGTGCTGCTC | ||
GAPDH forward: | TCCCTGAGCTGAACGGGAAG | ||
GAPDH reverse: | GGAGGAGTTTGGTCGCTGT | ||
qPCR Primers | |||
full-length SMN2 forward: | GCTATCATACTGGCTATTATATGGGTTTT | ||
full-length SMN2 reverse: | CTCTATGCCAGCATTTCTCCTTAAT | ||
∆7 SMN2 forward: | TCTGGACCACCAATAATTCCCC | ||
∆7 SMN2 reverse: | ATGCCAGCATTTCCATATAATAGCC | ||
GAPDH forward: | GCAAATTCCATGGCACCGT | ||
GAPDH reverse: | AGGGATCTCGCTCCTGGAA | ||
Chloroform | Sigma-Aldrich | P3803 | |
Glycogen, RNA grade | Thermo Fisher | R0551 | |
ImageJ Software | |||
Protease cocktail inhibitor | Roche | 11836153001 | |
Cathode Buffer | 0.025 M Tris base + 40 mM 6-aminocaproic acid + 20% Methanol | ||
Anode Buffer | 0.03 M Tris Base + 20% Methanol | ||
Concentred Anode Buffer | 0.3 M Tris base + 20% Methanol | ||
Beta Mercaptoethanol | Millipore | ES-007-E | |
PVDF membrane | GE | 10600021 | |
Loading/sample buffer for Western blotting | NuPage Invitrogen | NP007 | |
One-Step RT-PCR kit | Qiagen | 210210 | |
dNTPs | Clontech | 3040 |