This procedure will demonstrate how we synthesized and characterized the anti-NFκB and anti-cancer stem cell activity of an aspirin-fumarate prodrug.
Enflamasyon metastazı kanser insidansını ve tanıtım, ve sonunda ilerlemesini altında yatan bir kanser özelliğidir. Bu nedenle, standart kanser alaylara karşı bir anti-inflamatuar ilaç eklenmesi hasta sonuçlarını artırabilir. Bu tür bir madde, aspirin (asetilsalisilik asit, ASA), kanserinin kimyasal yollardan önlenmesine ve anti-tümör aktivitesi için incelenmiştir. siklooksijenaz 2-prostaglandin ekseni inhibe yanı sıra, ASA anti-kanser aktiviteleri, aynı zamanda nükleer faktör ĸB (NFĸB) inhibisyonuna bağlanmıştır. Uzun süreli ASA kullanımının sindirim toksisiteye neden olabilir, çünkü bir ön stratejisi başarıyla uygulanmaktadır. Bu ön ilacın içinde ASA karboksilik asit maskeli ve ek farmakoforlarına dahil edilir tasarımı.
Bu protokol, biz aspirin fumarat ön ilacı GTCpFE sentezlendi ve meme kanseri hücrelerinde NFĸB yolunun önlemesini, özelliği, kanser zayıflaması mil benzeri uygun açıklamaktadırkravat, önemli bir NFĸB bağımlı fenotip. ASA ASA yapısına eklenmesi fumarat önemli ölçüde etkinliğine katkıda bulunduğunu belirten, herhangi bir inhibe edici aktiviteye yoksun ise GTCpFE, meme kanseri hücre hatlarında NFĸB yolu inhibite eder. Immünfenotip – Buna ek olarak, GTCpFE mammosphere oluşumunu engelleme ve kanser kök hücresi ile ilişkili CD44 + CD24 hafifleterek önemli anti-kanser kök hücre aktivitesi gösterir. Bu sonuçlar kemoprevensiyon ve kanser tedavisi için geliştirilmiş bir anti-inflamatuar ilaçlar geliştirmek için uygun bir strateji oluşturmak.
Enflamasyon böyle metastazı 1'e insidansı ve tanıtım, ve sonunda ilerleme olarak tümörogenez birden yönlerini altında yatan bir özelliğidir. Meme kanserinde, bu daha da metastaz ve nüks hem meme kanseri insidansı azalma ve riski ile ilişkilidir (salisilik asit, ASA asetil) klasik non-steroid anti-inflamatuar ilaç aspirin o düzenli kullanımını gösteren epidemiyolojik gözlemlerle desteklenmektedir 2,3. ASA esas Meme kanseri 4,5 yukarı regüle edilir, siklooksijenaz-2 aktivitesini inhibe ederek etki eder. Ancak, ASA anti-kanser etkileri de anormal nükleer faktör KB'yi (NFKB) 6-8 sinyal bastırılması aracılık edebilir. Bir kuralsız NFKB yolu tedavisine 9-11 tümör hücre sağkalım, çoğalması, göç, işgali, anjiogenezisi ve direncini arttırır, çünkü bu önemlidir. NFKB yolu aktivasyonu da monte edilmesi için çok önemlidirBir bağışıklık tepkisi. Bu nedenle, uzun süreli NFKB inhibisyonunun gerekli olduğu bir anti-kanser terapisi, bir uzun süreli bir bağışıklık bastırma kapsayan zararlı yan etkileri göz önünde bulundurulmalıdır. Bu nedenle, ASA tedavi optimizasyonu için iyi bir başlangıç noktası olarak hizmet verebilir.
Kanser terapisinde ASA uygulama için bir sınırlama örneğin ülser ve mide 12,13 kanama gibi, mide-bağırsak toksisitesi ile bağlantılı olan siklooksijenaz 2 ve NFKB inhibisyonu için gerekli olan yükseltilmiş dozlar vardır. Ancak, ester ön ilacı haline ASA dönüştürerek, ASA gastrointestinal toksisite azaltabilir. ayrıca gücünü artırmak ve / veya işlevsellik eklemek için, ek yapı elemanları veya yardımcı farmakoforlarına da ester ön tasarımına dahil edilebilir. Bu tür bir farmakofor NFKB yolu fumarattır karşı daha önce NFKB yolu inhibisyonu 14,15 için önemli olduğu gösterilmiştir ki, ASA gücünü arttırmak için ilave edildi.
<p class="jove_content"> Biz aspirin fumarat ön ilacı sentezlenmiş 15, GTCpFE ve bu hibrid molekül henüz NFKB yolunun karşı güçlü güvenli olacağını varsaydık. Meme kanseri hücreleri içinde, anti-NFKB aktivitesini ve NFKB yaşama ve büyüme 16-21 için sinyal kullanan meme kanseri kök hücreleri (rulmanları) 15, bloke etme kabiliyetini test etmiştir. Biz NFKB yolunun karşı GTCpFE gücü önemli ölçüde ASA 15 üzerinde geliştirilmiş olduğunu bulmak. Buna ek olarak, GTCpFE blok mammosphere oluşumu ve CSC yüzey işaretleyici CD44 + CD24 azaltır – GTCpFE CSCS 15 yok etme kapasitesine sahip olduğunu gösteren, immünfenotip. Bu sonuçlar, aynı zamanda, meme CSCS hedefleyebilir etkili bir anti-enflamatuvar ajan olarak aspirin fumarat ön-ilaç oluşturmak. Meme kanseri tedavisi açısından, GTCpFE agresif ve ölümcül hastalığın tedavisinde bir potansiyele sahip olabilir.In this protocol, we demonstrated the synthesis of an ASA prodrug, GTCpFE, where the fumarate pharmacophore was incorporated to improve the anti-NFĸB activity in breast cancer cells. GTCpFE is an effective NFĸB inhibitor, whereas ASA itself is not, even at much higher concentrations. The fumarate moiety has anti-inflammatory properties as shown by its ability to inhibit NFĸB signaling in a variety of cell lines and tissues14,25-29. The prodrug strategy described herein, is amendable to other mal…
The authors have nothing to disclose.
This work was supported by grants provided by the National Institutes of Health (NIH), R01 CA200669 to JF and R01 CA121107 to GRJT, and by a postdoctoral fellowship grant from Susan G. Komen for the Cure to IK (PDF12229484).
RPMI 1640 Red Medium | Life Technologies | 11875-093 | Warm up to 37°C before use |
IMEM | Corning | 10-024-CV | Warm up to 37°C before use |
DMEM / F12 Medium | ThermoFisher | 21041-025 | Warm up to 37°C before use |
MEM NEAA 10mM 100X | Life Technologies | 11140 | |
Penicillin Streptomycin | Life Technologies | 15140-122 | |
L-Glutamine 100X | Life Technologies | 25030-081 | |
Insulin | Sigma-Aldrich | I-1882 | |
Fetal Bovine Serum | Atlanta Biologicals | S11150 | |
Trypsin 2.5% 10X | Invitrogen | 15090046 | |
Methyl Cellulose | Sigma | M0262 | |
B27 Supplement 50X | Gibco | 17504-044 | |
EGF | Gibco | PHG0311L | |
NFκB-RE Luciferase Construct | Clontech | pGL4.32 | |
Renilla Luciferase Construct | Promega | pGL4.70 | |
Lipofectamine 2000 | ThermoFisher | 11668-019 | |
Dual-Luciferase Reporter Assay | Promega | 120000032 | |
NanoDrop Spectrophotometer | ThermoFisher | ||
Eppendorf Mastercycler | Eppendorf | ||
StepOne Real Time PCR System | Thermo Scientific | ||
Eclipse Microscope | Nikon | ||
CyAn ADP Analyzer | Beckman Coulter | ||
QCapture Software | QImaging | ||
Summit Software | Beckman Coulter | ||
GraphPad Software | Prism | ||
TRIzol | ThermoFisher | 15596-018 | |
M-MLV Reverse Transcriptase | Invitrogen | 28025-013 | |
100 mM dNTP Set | Invitrogen | 10297-018 | |
Random Hexamers | Invitrogen | 48190-011 | |
Fast SYBR Green Master Mix | ThermoFisher | 4385612 | |
Costar 96W, ultra low attachment | Corning | 3474 | |
HBSS, 1X | ThermoFisher | 14025134 | |
CD44-APC conjugated antibody | BD Pharmingen | 560990 | Store at 4°C, protect from light |
CD24-PE antibody | BD Pharmingen | 560991 | Store at 4°C, protect from light |
Recombinant Human TNFα | Fisher | 210TA100 | |
CCL2 Primer Forward Sequence | AGAATCACCAGCAGCAAGTGTCC | ||
CCL2 Primer Reverse Sequence | TCCTGAACCCACTTCTGCTTGG | ||
ICAM1 Primer Reverse Sequence | TGACGAAGCCAGAGGTCTCAG | ||
ICAM1 Primer Forward Sequence | AGCGTCACCTTGGCTCTAGG | ||
TNF Primer Forward Sequence | AAGGGTGACCGACTCAGCG | ||
TNF Primer Reverse Sequence | ATCCCAAAGTAGACCTGCCCA | ||
36B4 Primer Forward Sequence | GTGTTCGACAATGGCAGCAT | ||
36B4 Primer Reverse Sequence | GACACCCTCCAGGAAGCGA | ||
Sodium Hydroxide | Sigma-Aldrich | S5881-500G | |
4-Hydroxybenzyl Alcohol | Sigma-Aldrich | 20806-10G | |
O-Acetylsalicyloyl Chloride | Sigma-Aldrich | 165190-5G | |
Phosphorous Pentoxide | Sigma-Aldrich | 79610-100G | |
Ethyl Fumaroyl Chloride | Sigma-Aldrich | 669695-1G | |
Sodium Sulfate | Sigma-Aldrich | 246980-500G | |
4-Dimethylaminopyridine | Sigma-Aldrich | 714844-100ML | 0.5 M in tetrahydrofuran |
Triethylamine | Sigma-Aldrich | T0886-100ML | |
Toluene | Sigma-Aldrich | 244511-100ML | |
Ethyl Acetate | Sigma-Aldrich | 270989-100ML | |
Tetrahydrofuran | Sigma-Aldrich | 401757-2L | |
400 MHz FT NMR spectrometer | See Bruker’s Avance User’s Manual, version 000822 for details |