This procedure will demonstrate how we synthesized and characterized the anti-NFκB and anti-cancer stem cell activity of an aspirin-fumarate prodrug.
염증 전이에 암 발생 및 홍보, 결국 진행의 기초가 암의 특징이다. 따라서, 표준 암 연대에 소염제를 추가하는 것은 환자의 결과를 향상시킬 수있다. 그러한 약물 아스피린 (아세틸 살리실산, ASA)은, 암 화학 예방법 및 항 종양 활성에 대해 탐구되었다. 시클로 옥 시게나 제 2 축 프로스타글란딘 억제 외에 ASA의 항암 활동은 핵 인자 ĸB (NFĸB) 억제에 기인하고있다. ASA 장시간 사용이 위장관 독성을 유발할 수 있기 때문에, 프로 드럭 전략이 성공적으로 구현되었다. 이 전구 약물에 ASA의 카르 복실 산 마스크 추가 약물 조제가 통합되어 설계.
이 프로토콜은 우리가 아스피린 푸마르산 전구 약물 GTCpFE 합성 및 유방암 세포에서 NFĸB 경로의 억제를 그 특징으로하며 암의 감쇠 줄기 등 적절한 방법을 설명넥타이, 중요한 NFĸB 의존 표현형. ASA는 ASA 구조에 추가 푸마 상당히 활성에 기여하고 있음을 나타내는 임의의 억제 활성이 결여 반면 GTCpFE 효과적으로 유방암 세포주에서 NFĸB 경로를 억제한다. 면역 표현형 – 또한, GTCpFE는 mammosphere 형성을 차단하고 암 줄기 세포 관련 CD44 + CD24를 감쇠에 의해 상당한 항암 줄기 세포의 활동을 보여줍니다. 이들 결과는 화학적 예방 및 암 치료를위한 개선 된 항 – 염증 약물의 개발이 가능한 전략을 수립.
염증은 전이 1 입사 및 승진, 결국 진행으로 종양의 여러 측면을, 기초가 품질 증명이다. 유방암이 더욱 전이 및 재발 모두 유방암 발병률 감소, 위험과 연관된다 (살리실산, ASA 아세틸) 고전적인 비 스테로이드 성 항 염증 약물 아스피린의 일정한 사용을 나타내는 역학 관측에 의해지지된다 2,3. ASA 주로 종종 유방암 4,5-에서 상향 조절된다 사이클로 옥 시게나 제 -2 활성을 억제함으로써 작용한다. 그러나, ASA의 항암 효과는 비정상적인 핵 인자 κB (NFκB) 6-8 시그널링의 억제에 의해 매개 될 수있다. 규제 완화 NFκB 경로는 치료 9-11로 종양 세포의 생존, 증식, 이동, 침윤, 혈관 신생, 및 저항을 촉진하기 때문에 중요하다. NFκB 경로의 활성화는 또한 장착 중요하다면역 반응. 따라서, 장기간 NFκB의 억제가 요구되는 항암 치료를 들어, 하나의 긴 지속 면역 억제와 관련된 해로운 부작용을 고려해야한다. 따라서, 치료는 ASA 최적화를위한 좋은 출발점이 될 수있다.
암 치료에 ASA 응용 프로그램에 대한 하나의 한계는 궤양과 위가 12, 13 출혈로 위장 독성과 관련된 사이클로 옥 시게나 제 2, NFκB 억제에 필요한 높은 용량입니다. 그러나, 에스테르 전구 약물로 ASA 변환, ASA의 위장 독성을 감소시킬 수있다. 상기 효능을 향상 및 / 또는 기능을 추가하는 추가적인 구성 요소 또는 부수적 인 약물 조제도 에스테르 프로 드럭 디자인에 혼입 될 수있다. 그러한 pharmacophore는 NFκB 경로가 푸마 레이트 인에 대해 우리가 이전에 NFκB 경로 억제 14,15 중요한 것으로 나타났습니다있는 ASA의 힘을 강화했다.
<p class="jove_content은"> 우리는 아스피린 – 푸마 레이트의 전구 약물을 합성 (15), GTCpFE 및 하이브리드 분자가 아직 NFκB 경로에 대한 강력한 안전 할 것이라는 가설을 세웠다. 우리는 유방암 세포에서의 항 NFκB 활성 및 NFκB 생존 및 성장을 위해 16-21 신호에 의존 유방암 줄기 세포 (CSC 추가) (15)을 차단하는 능력을 시험 하였다. 우리는 NFκB 경로에 대한 GTCpFE의 힘이 크게 ASA (15)을 통해 향상된다 찾을 수 있습니다. 또한, GTCpFE 블록 mammosphere 형성 및 CSC 표면 마커 CD44 + CD24 감쇠 – GTCpFE가 된 CSC (15)를 퇴치 할 수있는 것을 나타내는, 면역 표현형한다. 이러한 결과는 유방 암줄 기세포를 타겟팅 할 수있는 효과적인 소염제로서 아스피린 – 푸마 레이트의 전구 약물을 설정합니다. 유방암 치료의 관점에서, GTCpFE 공격적인 치명적인 질병을 치료할 수있는 가능성을 가지고있다.In this protocol, we demonstrated the synthesis of an ASA prodrug, GTCpFE, where the fumarate pharmacophore was incorporated to improve the anti-NFĸB activity in breast cancer cells. GTCpFE is an effective NFĸB inhibitor, whereas ASA itself is not, even at much higher concentrations. The fumarate moiety has anti-inflammatory properties as shown by its ability to inhibit NFĸB signaling in a variety of cell lines and tissues14,25-29. The prodrug strategy described herein, is amendable to other mal…
The authors have nothing to disclose.
This work was supported by grants provided by the National Institutes of Health (NIH), R01 CA200669 to JF and R01 CA121107 to GRJT, and by a postdoctoral fellowship grant from Susan G. Komen for the Cure to IK (PDF12229484).
RPMI 1640 Red Medium | Life Technologies | 11875-093 | Warm up to 37°C before use |
IMEM | Corning | 10-024-CV | Warm up to 37°C before use |
DMEM / F12 Medium | ThermoFisher | 21041-025 | Warm up to 37°C before use |
MEM NEAA 10mM 100X | Life Technologies | 11140 | |
Penicillin Streptomycin | Life Technologies | 15140-122 | |
L-Glutamine 100X | Life Technologies | 25030-081 | |
Insulin | Sigma-Aldrich | I-1882 | |
Fetal Bovine Serum | Atlanta Biologicals | S11150 | |
Trypsin 2.5% 10X | Invitrogen | 15090046 | |
Methyl Cellulose | Sigma | M0262 | |
B27 Supplement 50X | Gibco | 17504-044 | |
EGF | Gibco | PHG0311L | |
NFκB-RE Luciferase Construct | Clontech | pGL4.32 | |
Renilla Luciferase Construct | Promega | pGL4.70 | |
Lipofectamine 2000 | ThermoFisher | 11668-019 | |
Dual-Luciferase Reporter Assay | Promega | 120000032 | |
NanoDrop Spectrophotometer | ThermoFisher | ||
Eppendorf Mastercycler | Eppendorf | ||
StepOne Real Time PCR System | Thermo Scientific | ||
Eclipse Microscope | Nikon | ||
CyAn ADP Analyzer | Beckman Coulter | ||
QCapture Software | QImaging | ||
Summit Software | Beckman Coulter | ||
GraphPad Software | Prism | ||
TRIzol | ThermoFisher | 15596-018 | |
M-MLV Reverse Transcriptase | Invitrogen | 28025-013 | |
100 mM dNTP Set | Invitrogen | 10297-018 | |
Random Hexamers | Invitrogen | 48190-011 | |
Fast SYBR Green Master Mix | ThermoFisher | 4385612 | |
Costar 96W, ultra low attachment | Corning | 3474 | |
HBSS, 1X | ThermoFisher | 14025134 | |
CD44-APC conjugated antibody | BD Pharmingen | 560990 | Store at 4°C, protect from light |
CD24-PE antibody | BD Pharmingen | 560991 | Store at 4°C, protect from light |
Recombinant Human TNFα | Fisher | 210TA100 | |
CCL2 Primer Forward Sequence | AGAATCACCAGCAGCAAGTGTCC | ||
CCL2 Primer Reverse Sequence | TCCTGAACCCACTTCTGCTTGG | ||
ICAM1 Primer Reverse Sequence | TGACGAAGCCAGAGGTCTCAG | ||
ICAM1 Primer Forward Sequence | AGCGTCACCTTGGCTCTAGG | ||
TNF Primer Forward Sequence | AAGGGTGACCGACTCAGCG | ||
TNF Primer Reverse Sequence | ATCCCAAAGTAGACCTGCCCA | ||
36B4 Primer Forward Sequence | GTGTTCGACAATGGCAGCAT | ||
36B4 Primer Reverse Sequence | GACACCCTCCAGGAAGCGA | ||
Sodium Hydroxide | Sigma-Aldrich | S5881-500G | |
4-Hydroxybenzyl Alcohol | Sigma-Aldrich | 20806-10G | |
O-Acetylsalicyloyl Chloride | Sigma-Aldrich | 165190-5G | |
Phosphorous Pentoxide | Sigma-Aldrich | 79610-100G | |
Ethyl Fumaroyl Chloride | Sigma-Aldrich | 669695-1G | |
Sodium Sulfate | Sigma-Aldrich | 246980-500G | |
4-Dimethylaminopyridine | Sigma-Aldrich | 714844-100ML | 0.5 M in tetrahydrofuran |
Triethylamine | Sigma-Aldrich | T0886-100ML | |
Toluene | Sigma-Aldrich | 244511-100ML | |
Ethyl Acetate | Sigma-Aldrich | 270989-100ML | |
Tetrahydrofuran | Sigma-Aldrich | 401757-2L | |
400 MHz FT NMR spectrometer | See Bruker’s Avance User’s Manual, version 000822 for details |