This procedure will demonstrate how we synthesized and characterized the anti-NFκB and anti-cancer stem cell activity of an aspirin-fumarate prodrug.
דלקת היא סימן היכר סרטן העומד בבסיס שכיחות סרטן וקידום, והתקדמות בסופו של דבר גרור. לפיכך, הוספת תרופה אנטי דלקתית אל גדודי סרטן תקניים לשפר את תוצאת מטופל. תרופה כזו אחת, אספירין (חומצה אצטילסליצילית, אס"א), נחקרה עבור מניעה כימית סרטן ופעילות אנטי-סרטנית. מלבד עיכוב ציר 2-פרוסטגלנדין cyclooxygenase, פעילות אנטי-סרטנית של אס"א גם יוחסו הפקטור הגרעיני ĸB (NFĸB) עיכוב. בגלל שימוש אס"א ממושך עלול לגרום לרעילויות במערכת עיכול, אסטרטגית prodrug יושמה בהצלחה. בשנת prodrug זה לעצב את חומצה קרבוקסילית של אס"א מוסווה ו pharmacophores נוספים משולבים.
פרוטוקול זה מתאר כיצד אנחנו מסונתזים prodrug fumarate האספירין, GTCpFE, ומאופיינת העיכוב של מסלול NFĸB בתאי סרטן שד ההנחתה של סרטן הגבעולי נאהעניבות, פנוטיפ NFĸB התלוי חשוב. GTCpFE ביעילות מעכבת את מסלול NFĸB בשורות תאי סרטן השד ואילו אס"א חסר כל פעילות מעכבת, המציין כי הוספת fumarate למבנה אס"א תורם באופן משמעותי את פעילותה. בנוסף, GTCpFE מראה פעילות תאי גזע נגד סרטן משמעותי על ידי חסימת היווצרות mammosphere ו משפשפים את הסרט CD44 הקשורים תא גזע סרטניים + CD24 – immunophenotype. תוצאות אלו להקים אסטרטגיה מעשית לפיתוח תרופות אנטי-דלקתיות משופרות עבור מניעה כימית וטיפול בסרטן.
דלקת היא סימן ההיכר העומד בבסיס מגוון רחב של אספקטים tumorigenesis, כגון שכיחות וקידום, והתקדמות בסופו של דבר גרורות 1. בשנת סרטן השד, זה נתמך גם על ידי תצפיות אפידמיולוגיים מראים כי שימוש קבוע של אספירין תרופה קלאסית סטרואידיות נוגדות דלקת לא סטרואידיות (אצטיל חומצה סליצילית, אס"א) קשורה עם ירידה בשני שכיחות סרטן השד, והסיכון של גרורות והישנות 2,3. אס"א פועל בעיקר על ידי עיכוב cyclooxygenase-2 פעילות, אשר שהוגברה לעתים קרובות בסרטן השד 4,5. עם זאת, ההשפעות האנטי-סרטניות של אס"א יכול להיות גם מתווכת על ידי דיכוי κB הפקטור הגרעיני סוטה (NFκB) איתות 6-8. זה חשוב כי מסלול NFκB deregulated מקדם הישרדות תאי גידול, התפשטות, הגירה, פלישה, אנגיוגנזה, והתנגדות לטיפול 9-11. הפעלת מסלול NFκB הנה עניין מהותי הרכבה תגובה חיסונית. לכן, עבור טיפול נגד סרטן שבו עיכוב NFκB ממושך נדרש, יש לקחת בחשבון את תופעות לוואי מזיקות מעורבות לטווח ארוך דיכוי מערכת חיסוני. לפיכך, אס"א עשוי לשמש נקודת התחלה טובה עבור אופטימיזציה טיפולית.
מגבלה אחת עבור יישום אס"א בטיפול בסרטן היא במינונים הגבוהים הנדרשים cyclooxygenase 2 ועיכוב NFκB, אשר משויכים רעיל במערכת עיכול, כגון כיבים בקיבת דימום 12,13. עם זאת, המרת אס"א לתוך prodrug אסתר כמו, עשוי להפחית רעילות במערכת העיכול של אס"א. כדי לשפר עוד יותר את העוצמה ואת / או להוסיף פונקציונליות, אלמנטים מבניים נוספים או pharmacophores עזר יכול גם להיות משולב בתוך עיצוב prodrug אסתר. Pharmacophore אחד כזה הוסיף כדי לשפר אונות אס"א נגד מסלול NFκB הוא fumarate, אשר בעבר הראינו להיות חשוב עבור עיכוב מסלול NFκB 14,15.
<p class="jove_content"> אנחנו מסונתז prodrug אספירין-fumarate 15, GTCpFE, ואת שיערו כי מולקולה היברידית כזה יהיה בטוח עדיין חזקה נגד מסלול NFκB. בדקנו פעילות אנטי-NFκB שלה בתאי סרטן השד ועל יכולתה לחסום תאי גזע של סרטן השד (CSCS) 15, אשר מסתמכים על NFκB איתות עבור 16-21 הישרדות וצמיחה. אנו מוצאים כי העוצמה של GTCpFE נגד מסלול NFκB הוא השתפר באופן משמעותי על אס"א 15. בנוסף, בלוקים GTCpFE היווצרות mammosphere ו פוחתת CD44 סמן משטח CSC + CD24 – immunophenotype, המציין כי GTCpFE מסוגל בביעור CSCS 15. תוצאות אלו להקים את prodrug האספירין-fumarate כסוכן אנטי דלקתי יעיל כי גם יכול למקד CSCS שד. במונחים של טיפול בסרטן השד, GTCpFE יכול להיות פוטנציאל לטפל מחלה אגרסיבית וקטלנית.In this protocol, we demonstrated the synthesis of an ASA prodrug, GTCpFE, where the fumarate pharmacophore was incorporated to improve the anti-NFĸB activity in breast cancer cells. GTCpFE is an effective NFĸB inhibitor, whereas ASA itself is not, even at much higher concentrations. The fumarate moiety has anti-inflammatory properties as shown by its ability to inhibit NFĸB signaling in a variety of cell lines and tissues14,25-29. The prodrug strategy described herein, is amendable to other mal…
The authors have nothing to disclose.
This work was supported by grants provided by the National Institutes of Health (NIH), R01 CA200669 to JF and R01 CA121107 to GRJT, and by a postdoctoral fellowship grant from Susan G. Komen for the Cure to IK (PDF12229484).
RPMI 1640 Red Medium | Life Technologies | 11875-093 | Warm up to 37°C before use |
IMEM | Corning | 10-024-CV | Warm up to 37°C before use |
DMEM / F12 Medium | ThermoFisher | 21041-025 | Warm up to 37°C before use |
MEM NEAA 10mM 100X | Life Technologies | 11140 | |
Penicillin Streptomycin | Life Technologies | 15140-122 | |
L-Glutamine 100X | Life Technologies | 25030-081 | |
Insulin | Sigma-Aldrich | I-1882 | |
Fetal Bovine Serum | Atlanta Biologicals | S11150 | |
Trypsin 2.5% 10X | Invitrogen | 15090046 | |
Methyl Cellulose | Sigma | M0262 | |
B27 Supplement 50X | Gibco | 17504-044 | |
EGF | Gibco | PHG0311L | |
NFκB-RE Luciferase Construct | Clontech | pGL4.32 | |
Renilla Luciferase Construct | Promega | pGL4.70 | |
Lipofectamine 2000 | ThermoFisher | 11668-019 | |
Dual-Luciferase Reporter Assay | Promega | 120000032 | |
NanoDrop Spectrophotometer | ThermoFisher | ||
Eppendorf Mastercycler | Eppendorf | ||
StepOne Real Time PCR System | Thermo Scientific | ||
Eclipse Microscope | Nikon | ||
CyAn ADP Analyzer | Beckman Coulter | ||
QCapture Software | QImaging | ||
Summit Software | Beckman Coulter | ||
GraphPad Software | Prism | ||
TRIzol | ThermoFisher | 15596-018 | |
M-MLV Reverse Transcriptase | Invitrogen | 28025-013 | |
100 mM dNTP Set | Invitrogen | 10297-018 | |
Random Hexamers | Invitrogen | 48190-011 | |
Fast SYBR Green Master Mix | ThermoFisher | 4385612 | |
Costar 96W, ultra low attachment | Corning | 3474 | |
HBSS, 1X | ThermoFisher | 14025134 | |
CD44-APC conjugated antibody | BD Pharmingen | 560990 | Store at 4°C, protect from light |
CD24-PE antibody | BD Pharmingen | 560991 | Store at 4°C, protect from light |
Recombinant Human TNFα | Fisher | 210TA100 | |
CCL2 Primer Forward Sequence | AGAATCACCAGCAGCAAGTGTCC | ||
CCL2 Primer Reverse Sequence | TCCTGAACCCACTTCTGCTTGG | ||
ICAM1 Primer Reverse Sequence | TGACGAAGCCAGAGGTCTCAG | ||
ICAM1 Primer Forward Sequence | AGCGTCACCTTGGCTCTAGG | ||
TNF Primer Forward Sequence | AAGGGTGACCGACTCAGCG | ||
TNF Primer Reverse Sequence | ATCCCAAAGTAGACCTGCCCA | ||
36B4 Primer Forward Sequence | GTGTTCGACAATGGCAGCAT | ||
36B4 Primer Reverse Sequence | GACACCCTCCAGGAAGCGA | ||
Sodium Hydroxide | Sigma-Aldrich | S5881-500G | |
4-Hydroxybenzyl Alcohol | Sigma-Aldrich | 20806-10G | |
O-Acetylsalicyloyl Chloride | Sigma-Aldrich | 165190-5G | |
Phosphorous Pentoxide | Sigma-Aldrich | 79610-100G | |
Ethyl Fumaroyl Chloride | Sigma-Aldrich | 669695-1G | |
Sodium Sulfate | Sigma-Aldrich | 246980-500G | |
4-Dimethylaminopyridine | Sigma-Aldrich | 714844-100ML | 0.5 M in tetrahydrofuran |
Triethylamine | Sigma-Aldrich | T0886-100ML | |
Toluene | Sigma-Aldrich | 244511-100ML | |
Ethyl Acetate | Sigma-Aldrich | 270989-100ML | |
Tetrahydrofuran | Sigma-Aldrich | 401757-2L | |
400 MHz FT NMR spectrometer | See Bruker’s Avance User’s Manual, version 000822 for details |