This procedure will demonstrate how we synthesized and characterized the anti-NFκB and anti-cancer stem cell activity of an aspirin-fumarate prodrug.
L'inflammation est une caractéristique du cancer qui sous-tend l'incidence et de la promotion du cancer, et la progression éventuellement à des métastases. Par conséquent, l'ajout d'un médicament anti-inflammatoire à des régiments de cancer standards peut améliorer les résultats des patients. Un tel médicament, l'aspirine (acide acétylsalicylique, ASA), a été explorée pour la chimioprévention du cancer et de l'activité anti-tumorale. Outre l'inhibition de l'axe 2-prostaglandine cyclooxygénase, les activités anti-cancéreuses de l'ASA ont également été attribués à facteur nucléaire ĸB (NFĸB) inhibition. Parce que l'utilisation de l'AAS prolongé peut causer une toxicité gastro-intestinale, une stratégie de promédicament a été mis en œuvre avec succès. Dans cette conception promédicament l'acide carboxylique est masqué de l'ASA et des pharmacophores supplémentaires sont incorporés.
Ce protocole décrit la façon dont nous avons synthétisé un promédicament aspirine fumarate, GTCpFE, et caractérisé l'inhibition de la voie NFĸB dans les cellules cancéreuses du sein et de l'atténuation du cancer de la tige en forme correcteliens, une importante phénotype NFĸB dépendant. GTCpFE inhibe efficacement la voie NFĸB dans des lignées cellulaires de cancer du sein tandis que l'AAS est dépourvue d'activité inhibitrice, ce qui indique que l'ajout à la structure du fumarate ASA contribue de manière significative à son activité. En outre, GTCpFE montre anti-cancer activité de cellules souches significative en bloquant la formation mammosphere et atténuer la CD44 associée aux cellules souches du cancer + CD24 – immunophénotypage. Ces résultats établissent une stratégie viable pour développer des médicaments anti-inflammatoires améliorés pour la chimioprévention et le traitement du cancer.
L' inflammation est une caractéristique qui sous – tend plusieurs aspects de la tumorigenèse, tels que l' incidence et la promotion, et la progression éventuellement à des métastases 1. Dans le cancer du sein, il est en outre étayée par les observations épidémiologiques montrent que l'utilisation régulière de la non-stéroïdiens anti-inflammatoires de l'aspirine médicamenteuse classique (acide acétylsalicylique, ASA) est associée à une réduction à la fois l'incidence du cancer du sein et le risque de métastases et de la récurrence 2,3. ASA agit principalement en inhibant l' activité de la cyclooxygénase-2, qui est souvent régulé à la hausse dans le cancer du sein 4,5. Cependant, les effets anti-cancéreux d'ASA peuvent également être médiés par la suppression de facteur nucléaire kB aberrante (NFkB) de signalisation 6-8. Ceci est important car une voie de NFkB dérégulée favorise la survie des cellules tumorales, de la prolifération, la migration, l' invasion, l' angiogenèse et la résistance à la thérapie 11/09. activation de la voie NFkB est également critique pour le montageune réponse immunitaire. Par conséquent, pour un traitement anti-cancéreux, où l'inhibition de NFkB prolongée est requise, il faut tenir compte des effets secondaires néfastes impliquant une immunosuppression à long terme. Par conséquent, l'AAS peut servir comme un bon point de départ pour l'optimisation thérapeutique.
Une limitation à l' application ASA dans le traitement du cancer aux doses élevées requises pour l' inhibition de la cyclo – oxygénase 2 et de NFkB, qui sont associés à une toxicité gastro – intestinale, tels que les ulcères et les saignements de l' estomac 12,13. Toutefois, la conversion ASA en promédicament sous forme d'ester, peut réduire la toxicité gastro-intestinale de l'ASA. Afin d'améliorer davantage la puissance et / ou ajouter des fonctionnalités supplémentaires ou des éléments structuraux pharmacophores auxiliaires peuvent également être incorporés dans la conception de prodrogue ester. Un tel pharmacophore ajouté pour améliorer l' ASA puissance contre la voie NFkB est fumarate, que nous avons précédemment montré comme important pour l' inhibition de la voie NFkB 14,15.
<p class="jove_content"> Nous avons synthétisé une prodrogue aspirine-fumarate 15, GTCpFE, et émis l' hypothèse que cette molécule hybride serait sûr encore efficace contre la voie NFkB. Nous avons testé l'activité anti-NFkB dans les cellules cancéreuses du sein et de sa capacité à bloquer les cellules souches du cancer du sein (CCM) 15, qui reposent sur NFkB de signalisation pour la survie et la croissance 16-21. Nous constatons que la puissance de GTCpFE contre la voie NFkB est significativement améliorée par rapport à l' AAS 15. En outre, les blocs GTCpFE formation mammosphere et atténue la CSC marqueur de surface CD44 + CD24 – immunophénotypage, indiquant que GTCpFE est capable d'éradiquer CSCs 15. Ces résultats établissent le promédicament aspirine fumarate en tant qu'agent anti-inflammatoire efficace qui peut également cibler des cellules souches cancéreuses du sein. En termes de traitement du cancer du sein, GTCpFE peut avoir le potentiel pour traiter la maladie agressive et mortelle.In this protocol, we demonstrated the synthesis of an ASA prodrug, GTCpFE, where the fumarate pharmacophore was incorporated to improve the anti-NFĸB activity in breast cancer cells. GTCpFE is an effective NFĸB inhibitor, whereas ASA itself is not, even at much higher concentrations. The fumarate moiety has anti-inflammatory properties as shown by its ability to inhibit NFĸB signaling in a variety of cell lines and tissues14,25-29. The prodrug strategy described herein, is amendable to other mal…
The authors have nothing to disclose.
This work was supported by grants provided by the National Institutes of Health (NIH), R01 CA200669 to JF and R01 CA121107 to GRJT, and by a postdoctoral fellowship grant from Susan G. Komen for the Cure to IK (PDF12229484).
RPMI 1640 Red Medium | Life Technologies | 11875-093 | Warm up to 37°C before use |
IMEM | Corning | 10-024-CV | Warm up to 37°C before use |
DMEM / F12 Medium | ThermoFisher | 21041-025 | Warm up to 37°C before use |
MEM NEAA 10mM 100X | Life Technologies | 11140 | |
Penicillin Streptomycin | Life Technologies | 15140-122 | |
L-Glutamine 100X | Life Technologies | 25030-081 | |
Insulin | Sigma-Aldrich | I-1882 | |
Fetal Bovine Serum | Atlanta Biologicals | S11150 | |
Trypsin 2.5% 10X | Invitrogen | 15090046 | |
Methyl Cellulose | Sigma | M0262 | |
B27 Supplement 50X | Gibco | 17504-044 | |
EGF | Gibco | PHG0311L | |
NFκB-RE Luciferase Construct | Clontech | pGL4.32 | |
Renilla Luciferase Construct | Promega | pGL4.70 | |
Lipofectamine 2000 | ThermoFisher | 11668-019 | |
Dual-Luciferase Reporter Assay | Promega | 120000032 | |
NanoDrop Spectrophotometer | ThermoFisher | ||
Eppendorf Mastercycler | Eppendorf | ||
StepOne Real Time PCR System | Thermo Scientific | ||
Eclipse Microscope | Nikon | ||
CyAn ADP Analyzer | Beckman Coulter | ||
QCapture Software | QImaging | ||
Summit Software | Beckman Coulter | ||
GraphPad Software | Prism | ||
TRIzol | ThermoFisher | 15596-018 | |
M-MLV Reverse Transcriptase | Invitrogen | 28025-013 | |
100 mM dNTP Set | Invitrogen | 10297-018 | |
Random Hexamers | Invitrogen | 48190-011 | |
Fast SYBR Green Master Mix | ThermoFisher | 4385612 | |
Costar 96W, ultra low attachment | Corning | 3474 | |
HBSS, 1X | ThermoFisher | 14025134 | |
CD44-APC conjugated antibody | BD Pharmingen | 560990 | Store at 4°C, protect from light |
CD24-PE antibody | BD Pharmingen | 560991 | Store at 4°C, protect from light |
Recombinant Human TNFα | Fisher | 210TA100 | |
CCL2 Primer Forward Sequence | AGAATCACCAGCAGCAAGTGTCC | ||
CCL2 Primer Reverse Sequence | TCCTGAACCCACTTCTGCTTGG | ||
ICAM1 Primer Reverse Sequence | TGACGAAGCCAGAGGTCTCAG | ||
ICAM1 Primer Forward Sequence | AGCGTCACCTTGGCTCTAGG | ||
TNF Primer Forward Sequence | AAGGGTGACCGACTCAGCG | ||
TNF Primer Reverse Sequence | ATCCCAAAGTAGACCTGCCCA | ||
36B4 Primer Forward Sequence | GTGTTCGACAATGGCAGCAT | ||
36B4 Primer Reverse Sequence | GACACCCTCCAGGAAGCGA | ||
Sodium Hydroxide | Sigma-Aldrich | S5881-500G | |
4-Hydroxybenzyl Alcohol | Sigma-Aldrich | 20806-10G | |
O-Acetylsalicyloyl Chloride | Sigma-Aldrich | 165190-5G | |
Phosphorous Pentoxide | Sigma-Aldrich | 79610-100G | |
Ethyl Fumaroyl Chloride | Sigma-Aldrich | 669695-1G | |
Sodium Sulfate | Sigma-Aldrich | 246980-500G | |
4-Dimethylaminopyridine | Sigma-Aldrich | 714844-100ML | 0.5 M in tetrahydrofuran |
Triethylamine | Sigma-Aldrich | T0886-100ML | |
Toluene | Sigma-Aldrich | 244511-100ML | |
Ethyl Acetate | Sigma-Aldrich | 270989-100ML | |
Tetrahydrofuran | Sigma-Aldrich | 401757-2L | |
400 MHz FT NMR spectrometer | See Bruker’s Avance User’s Manual, version 000822 for details |