This procedure will demonstrate how we synthesized and characterized the anti-NFκB and anti-cancer stem cell activity of an aspirin-fumarate prodrug.
Inflammation is a cancer hallmark that underlies cancer incidence and promotion, and eventually progression to metastasis. Therefore, adding an anti-inflammatory drug to standard cancer regiments may improve patient outcome. One such drug, aspirin (acetylsalicylic acid, ASA), has been explored for cancer chemoprevention and anti-tumor activity. Besides inhibiting the cyclooxygenase 2-prostaglandin axis, ASA's anti-cancer activities have also been attributed to nuclear factor ĸB (NFĸB) inhibition. Because prolonged ASA use may cause gastrointestinal toxicity, a prodrug strategy has been implemented successfully. In this prodrug design the carboxylic acid of ASA is masked and additional pharmacophores are incorporated.
This protocol describes how we synthesized an aspirin-fumarate prodrug, GTCpFE, and characterized its inhibition of the NFĸB pathway in breast cancer cells and attenuation of the cancer stem-like properties, an important NFĸB-dependent phenotype. GTCpFE effectively inhibits the NFĸB pathway in breast cancer cell lines whereas ASA lacks any inhibitory activity, indicating that adding fumarate to ASA structure significantly contributes to its activity. In addition, GTCpFE shows significant anti-cancer stem cell activity by blocking mammosphere formation and attenuating the cancer stem cell associated CD44+CD24– immunophenotype. These results establish a viable strategy to develop improved anti-inflammatory drugs for chemoprevention and cancer therapy.
Inflammation is a hallmark that underlies multiple aspects of tumorigenesis, such as incidence and promotion, and eventually progression to metastasis1. In breast cancer, this is further supported by epidemiological observations showing that regular use of the classical non-steroidal anti-inflammatory drug aspirin (acetyl salicylic acid, ASA) is associated with a reduction in both breast cancer incidence, and risk of metastasis and recurrence2,3. ASA acts primarily by inhibiting cyclooxygenase-2 activity, which is often upregulated in breast cancer4,5. However, the anti-cancer effects of ASA may also be mediated by suppressing aberrant nuclear factor κB (NFκB) signaling6-8. This is important because a deregulated NFκB pathway promotes tumor cell survival, proliferation, migration, invasion, angiogenesis, and resistance to therapy9-11. NFκB pathway activation is also critical for mounting an immune response. Therefore, for anti-cancer therapy where prolonged NFκB inhibition is required, one must consider the detrimental side effects involving long-lasting immune suppression. Hence, ASA may serve as a good starting point for therapeutic optimization.
One limitation for ASA application in cancer therapy is the elevated doses required for cyclooxygenase 2 and NFκB inhibition, which are associated with gastrointestinal toxicity, such as ulcers and stomach bleeding12,13. However, converting ASA into as ester prodrug, may reduce ASA's gastrointestinal toxicity. To further enhance potency and/or add functionality, additional structural elements or ancillary pharmacophores may also be incorporated into ester prodrug design. One such pharmacophore added to enhance ASA potency against the NFκB pathway is fumarate, which we have previously shown to be important for NFκB pathway inhibition14,15.
We synthesized an aspirin-fumarate prodrug15, GTCpFE, and hypothesized that such hybrid molecule would be safe yet potent against the NFκB pathway. We tested its anti-NFκB activity in breast cancer cells and its ability to block breast cancer stem cells (CSCs)15, which rely on NFκB signaling for survival and growth16-21. We find that the potency of GTCpFE against the NFκB pathway is significantly improved over ASA15. In addition, GTCpFE blocks mammosphere formation and attenuates the CSC surface marker CD44+CD24– immunophenotype, indicating that GTCpFE is capable of eradicating CSCs15. These results establish the aspirin-fumarate prodrug as an effective anti-inflammatory agent that can also target breast CSCs. In terms of breast cancer therapy, GTCpFE may have the potential to treat aggressive and deadly disease.
1. Synthesis of Aspirin-fumarate Prodrug GTCpFE
2. GTCPFE Inhibits the NFĸB Activity in Breast Cancer Cells
3. GTCpFE Inhibits Breast Cancer Stem Cells In Vitro
In Figure 1, the chemical structure of aspirin-fumarate prodrug, GTCpFE, and its inhibitory activity on cytokine induced NFĸB pathway in breast cancer cells are indicated. GTCpFE inhibits both NFĸB endpoints, NFĸB-RE luciferase activity (Figure 1B) and expression of NFĸB target genes, such as Intercellular Adhesion Molecule 1 (ICAM1), Chemokine C-C Motif Ligand 2 (CCL2), and Tumor Necrosis Factor (TNF) (Figure 1C) in MCF-7 breast cancer cells. Calculated inhibitory concentration at 50% (IC50) value on both endpoints is ~20 µM. IC50 value is calculated using a graphing software. By comparison ASA itself even at 200 µM (10x IC50 of GTCpFE) shows no inhibitory activity (Figure 1B, blue line) in breast cancer cells. This indicates that the prodrug strategy of adding fumarate pharmacophore to ASA significantly improves its anti-NFĸB activity.
To measure the anti-CSC activity, we used two assays: the mammosphere (MS) formation assay and the population of cells expressing the CD44+CD24– immunophenotype, a bona fide CSC surface marker in breast cancer24. GTCpFE inhibits MS formation of MDA-MB-231 breast cancer cells in a dose dependent manner shown in Figure 2A. Similar to NFĸB pathway inhibition in adherent cultures, the IC50 value for mammosphere formation is ~20 µM. This consistency is expected, given that CSCs rely on NFĸB signaling for survival and propagation16-21. In addition, GTCpFE pre-treatment resulted in a significant depletion of the CD44+CD24– population (Figure 2B) in MDA-MB-231 cells. Together, these results establish GTCpFE's ability to effectively target breast CSCs.
Figure 1: GTCpFE inhibits the NFĸB pathway in breast cancer cells. (A) The chemical structure of the aspirin-fumarate prodrug, GTCpFE. (B–C) MCF-7 cells were pre-treated for 2 hr with various concentrations of GTCpFE, ASA, or vehicle followed by treatment with TNFα (10 ng/ml) for 2-4 hr. (B) NFκB-RE activity was measured by dual luciferase reporter assay. (C) Expression of NFκB target genes, ICAM1, CCL2 and TNF was measured by RT-QPCR. Drug inhibitory activity is plotted as % of TNFα alone. Data are presented as mean ± SEM. This figure has been modified from reference15. Please click here to view a larger version of this figure.
Figure 2: GTCpFE inhibits the mammosphere formation and the CD44+CD24– immunophenotype in breast cancer cells. (A) Mammosphere (MS) formation of MDA-MB-231 cells was measured after treatment with varying concentrations of GTCpFE. Quantitation of MS growth (left) and representative pictures of MS at 20X (right) are shown. The effect of GTCpFE is plotted as % vehicle control. (B) The CD44+CD24– population was determined by FACS analysis of MDA-MB-231 cells treated with 50 µM GTCpFE for 72 hr. Quantitation of each population percentage (left) and representative scatter plots from FACS (right) are shown. Data are presented as mean ± SEM and statistical analysis of 2-way ANOVA followed by Tukey posttest. *** P<0.001. This figure has been modified from reference15.
In this protocol, we demonstrated the synthesis of an ASA prodrug, GTCpFE, where the fumarate pharmacophore was incorporated to improve the anti-NFĸB activity in breast cancer cells. GTCpFE is an effective NFĸB inhibitor, whereas ASA itself is not, even at much higher concentrations. The fumarate moiety has anti-inflammatory properties as shown by its ability to inhibit NFĸB signaling in a variety of cell lines and tissues14,25-29. The prodrug strategy described herein, is amendable to other malignancies where multiple inflammatory pathways are active and contribute to the pathology. Therefore, GTCpFE may be the prototype for developing new fumarate-based anti-inflammatory and anti-CSC class of drugs. Besides ASA, other non-steroidal anti-inflammatory drugs may also be used. In this case, the synthetic route should be re-designed as well. Ensuring that the new prodrug maintains its anti-NFĸB and anti-cyclooxygenase activity via the assays describe herein is critical.
GTCpFE abrogated MS formation and inhibited the CD44+CD24– immunophenotype. Together these findings suggest that GTCpFE may also be a promising, clinically relevant anti-inflammatory molecule for eradicating breast CSCs by exploiting CSC’s reliance on multiple inflammatory pathways, including the NFĸB pathway and the cyclooxygenase 2-prostaglandin E2 axis16-21,30. Targeting breast CSCs is important because they are thought to contribute to therapy resistance, recurrence and metastasis31-34.
The anti-CSCs properties described here, the mammosphere formation and the CD44+CD24– immunophenotype, are based on typical in vitro assays to assess effect on stemness. Mammosphere formation is a functional assay because it exploits the unique property of stem-like/progenitor cells to survive and grow in serum-free suspension, while more differentiated cells undergo anoikis and die in these conditions35,36. However, because a reduction in mammosphere formation may represent (i) increased apoptosis, (ii) decreased proliferation of early progenitor cells or stem cells, (iii) a reduction in stem cell self-renewal, or (iv) interference with anchorage-independent growth, it is best used in conjunction with other anti-CSC assays. The choice of the well-established breast CSC CD44+CD24– immunophenotype is based on the pioneering study by Clarke and colleagues who used breast cancer xenografts to isolate a population of cells capable of initiating tumors in immunodeficient mice24. Similar to the CD44+CD24– immunophenotype, expression of other cell surface markers can be used to isolate stem cells via flow cytometry, but the choice of marker can greatly vary depending on tissues or species (human vs murine model). Alternative assays to measure effects on breast CSCs in vitro are (i) the side population technique, which is based on the ability of stem cells to exclude vital dyes via transmembrane transporters37, and (ii) the ALDEFLUOR assay, which is based on the enzymatic activity of aldehyde dehydrogenase 1 (ALDH1)38. Lastly, a suppression of pluripotency genes, transcription factors, or key stemness pathways may also be indicative of anti-CSCs effects. Promising in vitro anti-CSC properties should be followed up by in vivo characterization. The “gold standard” for assaying anti-CSC properties is in vivo tumorigenicity, wherein the ability of drug-treated cells to initiate or seed a xenograft tumor is examined39,40.
The authors have nothing to disclose.
This work was supported by grants provided by the National Institutes of Health (NIH), R01 CA200669 to JF and R01 CA121107 to GRJT, and by a postdoctoral fellowship grant from Susan G. Komen for the Cure to IK (PDF12229484).
RPMI 1640 Red Medium | Life Technologies | 11875-093 | Warm up to 37°C before use |
IMEM | Corning | 10-024-CV | Warm up to 37°C before use |
DMEM / F12 Medium | ThermoFisher | 21041-025 | Warm up to 37°C before use |
MEM NEAA 10mM 100X | Life Technologies | 11140 | |
Penicillin Streptomycin | Life Technologies | 15140-122 | |
L-Glutamine 100X | Life Technologies | 25030-081 | |
Insulin | Sigma-Aldrich | I-1882 | |
Fetal Bovine Serum | Atlanta Biologicals | S11150 | |
Trypsin 2.5% 10X | Invitrogen | 15090046 | |
Methyl Cellulose | Sigma | M0262 | |
B27 Supplement 50X | Gibco | 17504-044 | |
EGF | Gibco | PHG0311L | |
NFκB-RE Luciferase Construct | Clontech | pGL4.32 | |
Renilla Luciferase Construct | Promega | pGL4.70 | |
Lipofectamine 2000 | ThermoFisher | 11668-019 | |
Dual-Luciferase Reporter Assay | Promega | 120000032 | |
NanoDrop Spectrophotometer | ThermoFisher | ||
Eppendorf Mastercycler | Eppendorf | ||
StepOne Real Time PCR System | Thermo Scientific | ||
Eclipse Microscope | Nikon | ||
CyAn ADP Analyzer | Beckman Coulter | ||
QCapture Software | QImaging | ||
Summit Software | Beckman Coulter | ||
GraphPad Software | Prism | ||
TRIzol | ThermoFisher | 15596-018 | |
M-MLV Reverse Transcriptase | Invitrogen | 28025-013 | |
100 mM dNTP Set | Invitrogen | 10297-018 | |
Random Hexamers | Invitrogen | 48190-011 | |
Fast SYBR Green Master Mix | ThermoFisher | 4385612 | |
Costar 96W, ultra low attachment | Corning | 3474 | |
HBSS, 1X | ThermoFisher | 14025134 | |
CD44-APC conjugated antibody | BD Pharmingen | 560990 | Store at 4°C, protect from light |
CD24-PE antibody | BD Pharmingen | 560991 | Store at 4°C, protect from light |
Recombinant Human TNFα | Fisher | 210TA100 | |
CCL2 Primer Forward Sequence | AGAATCACCAGCAGCAAGTGTCC | ||
CCL2 Primer Reverse Sequence | TCCTGAACCCACTTCTGCTTGG | ||
ICAM1 Primer Reverse Sequence | TGACGAAGCCAGAGGTCTCAG | ||
ICAM1 Primer Forward Sequence | AGCGTCACCTTGGCTCTAGG | ||
TNF Primer Forward Sequence | AAGGGTGACCGACTCAGCG | ||
TNF Primer Reverse Sequence | ATCCCAAAGTAGACCTGCCCA | ||
36B4 Primer Forward Sequence | GTGTTCGACAATGGCAGCAT | ||
36B4 Primer Reverse Sequence | GACACCCTCCAGGAAGCGA | ||
Sodium Hydroxide | Sigma-Aldrich | S5881-500G | |
4-Hydroxybenzyl Alcohol | Sigma-Aldrich | 20806-10G | |
O-Acetylsalicyloyl Chloride | Sigma-Aldrich | 165190-5G | |
Phosphorous Pentoxide | Sigma-Aldrich | 79610-100G | |
Ethyl Fumaroyl Chloride | Sigma-Aldrich | 669695-1G | |
Sodium Sulfate | Sigma-Aldrich | 246980-500G | |
4-Dimethylaminopyridine | Sigma-Aldrich | 714844-100ML | 0.5 M in tetrahydrofuran |
Triethylamine | Sigma-Aldrich | T0886-100ML | |
Toluene | Sigma-Aldrich | 244511-100ML | |
Ethyl Acetate | Sigma-Aldrich | 270989-100ML | |
Tetrahydrofuran | Sigma-Aldrich | 401757-2L | |
400 MHz FT NMR spectrometer | See Bruker’s Avance User’s Manual, version 000822 for details |