This procedure will demonstrate how we synthesized and characterized the anti-NFκB and anti-cancer stem cell activity of an aspirin-fumarate prodrug.
التهاب هو السمة المميزة السرطان الذي يكمن وراء الإصابة بالسرطان والترويج، وتقدم في نهاية المطاف إلى ورم خبيث. لذلك، مضيفا عقار مضاد للالتهابات لأفواج السرطان القياسية قد تحسين نتائج المرضى. وقد تم اكتشاف واحدة من هذه المخدرات، والأسبرين (حمض الصفصاف، ASA)، على الوقاية الكيماوية السرطان والنشاط المضادة للورم. وبالاضافة الى تثبيط انزيمات الأكسدة الحلقية محور 2-البروستاجلاندين، وأيضا نسبت الأنشطة المضادة للسرطان ASA على العامل النووي ĸB (NFĸB) تثبيط. بسبب استخدام ASA لفترات طويلة قد يسبب سمية الجهاز الهضمي، وقد تم تنفيذ استراتيجية دواء مساعد بنجاح. في هذا دواء مساعد تصميم ملثمين حمض الكربوكسيلية من ASA وتدرج فارماكوفور إضافي.
يصف هذا البروتوكول كيفية تصنيعه ودواء مساعد الأسبرين فومرت، GTCpFE، وتتميز تثبيطه لمسار NFĸB في خلايا سرطان الثدي وتخفيف من السرطان الجذعية التي تشبه السليمالعلاقات، والنمط الظاهري NFĸB التي تعتمد على المهم. GTCpFE يمنع بشكل فعال مسار NFĸB في خطوط خلايا سرطان الثدي بينما ASA يفتقر إلى أي نشاط كابح، مشيرا إلى أن إضافة فومرت إلى هيكل ASA يساهم إلى حد كبير في نشاطها. وبالإضافة إلى ذلك، GTCpFE يظهر المضادة للسرطان نشاط كبير الخلايا الجذعية عن طريق عرقلة تشكيل mammosphere والتخفيف من الخلايا الجذعية السرطانية المرتبطة CD44 + CD24 – نمط ظاهري مناعي. هذه النتائج تضع استراتيجية قابلة للتطبيق لتطوير وتحسين العقاقير المضادة للالتهابات لالوقاية الكيماوية وعلاج السرطان.
التهاب هو السمة المميزة التي ترتكز عليها جوانب متعددة من تكون الأورام، مثل حدوث والترويج، وتقدم في نهاية المطاف إلى ورم خبيث 1. في سرطان الثدي، ويدعم هذا مزيدا من الملاحظات الوبائية تبين أن الاستخدام المنتظم للأسبرين المخدرات الكلاسيكية غير الستيرويدية المضادة للالتهابات (الاسيتيل حمض الصفصاف، ASA) ويرتبط مع انخفاض في كل من حدوث سرطان الثدي، وخطر ورم خبيث وتكرارها 2،3. ASA يعمل في المقام الأول عن طريق تثبيط انزيمات الأكسدة الحلقية 2-النشاط، والتي غالبا ما upregulated في سرطان الثدي 4،5. ومع ذلك، يمكن أيضا بوساطة تأثيرات مضادة للسرطان ASA عن طريق قمع الشاذة العامل النووي كيلوبايت (عامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة ) يشير 6-8. هذا أمر مهم لأن مسار عامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة حررت يعزز الورم بقاء الخلية، والانتشار، والهجرة، والغزو، الأوعية الدموية، ومقاومة للعلاج 11/09. عامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة تفعيل مسار أمر بالغ الأهمية أيضا لتركيب استجابة مناعية. لذلك، لعلاج مضاد للسرطان التي تتطلب فترات طويلة تثبيط عامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة، لا بد من النظر في الآثار الجانبية الضارة التي تنطوي طويلة الأمد قمع المناعي. وبالتالي، قد ASA بمثابة نقطة انطلاق جيدة لتعظيم الاستفادة العلاجية.
واحد الحد لتطبيق ASA في علاج السرطان هو جرعات مرتفعة المطلوبة للانزيمات الأكسدة الحلقية 2 وعامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة تثبيط، والتي ترتبط مع سمية الجهاز الهضمي، مثل قرحة المعدة ونزيف 12،13. ومع ذلك، وتحويل ASA إلى دواء مساعد كما استر، قد يقلل من سمية الجهاز الهضمي ASA ل. لتعزيز قوة و / أو إضافة وظائف، ويمكن أيضا أن تدمج العناصر الهيكلية إضافية أو فارماكوفور التبعية في تصميم استر دواء مساعد. وأضاف أحد هؤلاء حامل الخاصة الدوائية لتعزيز ASA قوة ضد مسار عامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة هو فومرت، الذي أظهرنا سابقا أن من المهم للعامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة طريق تثبيط 14،15.
<p class="jove_content"> نحن توليفها ودواء مساعد الأسبرين فومرت 15، GTCpFE، وافترض أن هذا الجزيء الهجين سوف يكون آمنا بعد قويا ضد مسار عامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة . نحن اختبار النشاط المضادة للعامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة في خلايا سرطان الثدي وقدرته على منع خلايا سرطان الثدي الجذعية (الخلايا الجذعية السرطانية) 15، والتي تعتمد على عامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة إشارات من أجل البقاء والنمو 16-21. نجد أن قوة من GTCpFE ضد مسار عامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة وتحسنت بشكل ملحوظ خلال ASA 15. وبالإضافة إلى ذلك، وكتل GTCpFE تشكيل mammosphere وخفف من ديوان الخدمة المدنية علامة سطح CD44 + CD24 – نمط ظاهري مناعي، مشيرا إلى أن GTCpFE قادر على القضاء على الخلايا الجذعية السرطانية 15. هذه النتائج هي من يضع دواء مساعد الأسبرين فومرت كعامل فعال مضاد للالتهابات التي يمكن أيضا استهداف الخلايا الجذعية السرطانية الثدي. من حيث العلاج سرطان الثدي، قد يكون GTCpFE القدرة على علاج مرض عدوانية وفتكا.In this protocol, we demonstrated the synthesis of an ASA prodrug, GTCpFE, where the fumarate pharmacophore was incorporated to improve the anti-NFĸB activity in breast cancer cells. GTCpFE is an effective NFĸB inhibitor, whereas ASA itself is not, even at much higher concentrations. The fumarate moiety has anti-inflammatory properties as shown by its ability to inhibit NFĸB signaling in a variety of cell lines and tissues14,25-29. The prodrug strategy described herein, is amendable to other mal…
The authors have nothing to disclose.
This work was supported by grants provided by the National Institutes of Health (NIH), R01 CA200669 to JF and R01 CA121107 to GRJT, and by a postdoctoral fellowship grant from Susan G. Komen for the Cure to IK (PDF12229484).
RPMI 1640 Red Medium | Life Technologies | 11875-093 | Warm up to 37°C before use |
IMEM | Corning | 10-024-CV | Warm up to 37°C before use |
DMEM / F12 Medium | ThermoFisher | 21041-025 | Warm up to 37°C before use |
MEM NEAA 10mM 100X | Life Technologies | 11140 | |
Penicillin Streptomycin | Life Technologies | 15140-122 | |
L-Glutamine 100X | Life Technologies | 25030-081 | |
Insulin | Sigma-Aldrich | I-1882 | |
Fetal Bovine Serum | Atlanta Biologicals | S11150 | |
Trypsin 2.5% 10X | Invitrogen | 15090046 | |
Methyl Cellulose | Sigma | M0262 | |
B27 Supplement 50X | Gibco | 17504-044 | |
EGF | Gibco | PHG0311L | |
NFκB-RE Luciferase Construct | Clontech | pGL4.32 | |
Renilla Luciferase Construct | Promega | pGL4.70 | |
Lipofectamine 2000 | ThermoFisher | 11668-019 | |
Dual-Luciferase Reporter Assay | Promega | 120000032 | |
NanoDrop Spectrophotometer | ThermoFisher | ||
Eppendorf Mastercycler | Eppendorf | ||
StepOne Real Time PCR System | Thermo Scientific | ||
Eclipse Microscope | Nikon | ||
CyAn ADP Analyzer | Beckman Coulter | ||
QCapture Software | QImaging | ||
Summit Software | Beckman Coulter | ||
GraphPad Software | Prism | ||
TRIzol | ThermoFisher | 15596-018 | |
M-MLV Reverse Transcriptase | Invitrogen | 28025-013 | |
100 mM dNTP Set | Invitrogen | 10297-018 | |
Random Hexamers | Invitrogen | 48190-011 | |
Fast SYBR Green Master Mix | ThermoFisher | 4385612 | |
Costar 96W, ultra low attachment | Corning | 3474 | |
HBSS, 1X | ThermoFisher | 14025134 | |
CD44-APC conjugated antibody | BD Pharmingen | 560990 | Store at 4°C, protect from light |
CD24-PE antibody | BD Pharmingen | 560991 | Store at 4°C, protect from light |
Recombinant Human TNFα | Fisher | 210TA100 | |
CCL2 Primer Forward Sequence | AGAATCACCAGCAGCAAGTGTCC | ||
CCL2 Primer Reverse Sequence | TCCTGAACCCACTTCTGCTTGG | ||
ICAM1 Primer Reverse Sequence | TGACGAAGCCAGAGGTCTCAG | ||
ICAM1 Primer Forward Sequence | AGCGTCACCTTGGCTCTAGG | ||
TNF Primer Forward Sequence | AAGGGTGACCGACTCAGCG | ||
TNF Primer Reverse Sequence | ATCCCAAAGTAGACCTGCCCA | ||
36B4 Primer Forward Sequence | GTGTTCGACAATGGCAGCAT | ||
36B4 Primer Reverse Sequence | GACACCCTCCAGGAAGCGA | ||
Sodium Hydroxide | Sigma-Aldrich | S5881-500G | |
4-Hydroxybenzyl Alcohol | Sigma-Aldrich | 20806-10G | |
O-Acetylsalicyloyl Chloride | Sigma-Aldrich | 165190-5G | |
Phosphorous Pentoxide | Sigma-Aldrich | 79610-100G | |
Ethyl Fumaroyl Chloride | Sigma-Aldrich | 669695-1G | |
Sodium Sulfate | Sigma-Aldrich | 246980-500G | |
4-Dimethylaminopyridine | Sigma-Aldrich | 714844-100ML | 0.5 M in tetrahydrofuran |
Triethylamine | Sigma-Aldrich | T0886-100ML | |
Toluene | Sigma-Aldrich | 244511-100ML | |
Ethyl Acetate | Sigma-Aldrich | 270989-100ML | |
Tetrahydrofuran | Sigma-Aldrich | 401757-2L | |
400 MHz FT NMR spectrometer | See Bruker’s Avance User’s Manual, version 000822 for details |