Synthese und Charakterisierung eines Aspirin-Fumarat Prodrug, die NFkB-Aktivität hemmt und Brustkrebs-Stammzellen
Summary
This procedure will demonstrate how we synthesized and characterized the anti-NFκB and anti-cancer stem cell activity of an aspirin-fumarate prodrug.
Abstract
Die Entzündung ist ein Krebs Markenzeichen, die Inzidenz von Krebserkrankungen und Förderung, und schließlich Progression zur Metastasierung zugrunde liegt. Daher ist ein entzündungshemmendes Medikament Zugabe zu Standard-Krebs Regimenter kann der Behandlungserfolg verbessern. Ein solches Medikament, Aspirin (Acetylsalicylsäure, ASA), wurde für die Krebschemoprävention und Antitumoraktivität untersucht. Neben Hemmung haben die Cyclooxygenase 2-Prostaglandin-Achse, ASA Anti-Krebs-Aktivitäten auch auf den Kernfaktor ĸB (NFĸB) Hemmung zugeschrieben worden. Da längere ASA Verwendung kann Magen-Darm-Toxizität verursachen, ein Prodrug Strategie wurde erfolgreich umgesetzt. In diesem Prodrug entwerfen die Carbonsäure von ASA maskiert und zusätzliche Pharmacophore eingebaut werden.
Dieses Protokoll beschreibt, wie man ein Aspirin-Fumarat Prodrug synthetisiert, GTCpFE und charakterisiert seine Hemmung der NFĸB Stoffwechselweg in Brustkrebszellen und Abschwächung des Krebsstielartigen richtigenKrawatten, ein wichtiger NFĸB abhängigen Phänotyp. GTCpFE hemmt wirksam die NFĸB Stoffwechselweg in Brustkrebszelllinien, während ASA irgendeine inhibitorische Aktivität fehlt, was darauf hinweist, dass das Hinzufügen Fumarat wesentlich zu ASA Struktur seiner Aktivität beiträgt. Zusätzlich zeigt GTCpFE signifikante Aktivität Stammzellen anti-Krebs durch mammosphere Bildung blockiert und die Krebsstammzellen CD44 + CD24 assoziiert Abschwächen – Immunphänotyp. Diese Ergebnisse schaffen eine tragfähige Strategie verbesserte entzündungshemmende Medikamente zu entwickeln, für die Chemoprävention und Krebstherapie.
Introduction
Die Entzündung ist ein Markenzeichen , die mehrere Aspekte der Tumorentstehung, wie Häufigkeit und Förderung, und schließlich Progression zur Metastasierung 1 zugrunde liegt. Bei Brustkrebs wird diese weiter durch epidemiologische Beobachtungen gestützt, dass die regelmäßige Anwendung des klassischen nicht-steroidale entzündungshemmende Medikament Aspirin (Acetylsalicylsäure, ASS) zeigt, die mit einer Senkung sowohl der Brustkrebs-Inzidenz und Risiko von Metastasen und Rezidiv assoziiert ist 2,3. ASA wirkt primär durch Cyclooxygenase-2 – inhibierende Aktivität, die oft in Brustkrebs 4,5 aufreguliert wird. Die Anti-Krebs – Wirkungen von ASA auch durch Unterdrückung aberrant nuclear factor & kgr; B (NFKB) Signalisierungs 6-8 jedoch vermittelt werden kann. Dies ist wichtig , weil eine deregulierte NFKB Stoffwechselweg Überleben von Tumorzellen fördert, Proliferation, Migration, Invasion, Angiogenese und Therapieresistenz 9-11. NFKB Signalweg-Aktivierung ist auch entscheidend für die Montageeiner Immunantwort. Daher ist für Anti-Krebs-Therapie, wo verlängerte NFKB Hemmung erforderlich ist, muß man die nachteiligen Nebenwirkungen beteiligt lang anhaltende Immunsuppression berücksichtigen. Daher kann ASA für therapeutische Optimierung als ein guter Ausgangspunkt dienen.
Eine Einschränkung für ASA – Anwendung in der Krebstherapie ist die erhöhte Dosen für Cyclooxygenase 2 erforderlich und NFKB – Hemmung, die mit Magen – Darm – Toxizität assoziiert sind, wie Magengeschwüre und Magen 12,13 Blutungen. Allerdings ASA in als Ester-Prodrug Umwandlung kann ASA Magen-Darm-Toxizität verringern. Zur weiteren Verbesserung der Wirksamkeit und / oder fügen Sie Funktionalität, zusätzliche strukturelle Elemente oder Neben Pharmacophore können auch in Ester-Prodrug-Design integriert werden. Eine solche Pharmakophormodell hinzugefügt ASA Potenz zu verbessern gegen die NFkB Weg Fumarat ist, die wir zuvor für NFkB Signalweg Hemmung 14,15 wichtig zu sein gezeigt.
<p class="jove_content"> Wir synthetisierten ein Aspirin-Fumarat Prodrug 15, GTCpFE, und die Hypothese aufgestellt , dass eine solche Hybridmolekül noch potent sicher sein würde gegen den NFkB Weg. Wir testeten ihre anti-NFKB – Aktivität in Brustkrebszellen und ihre Fähigkeit , Brustkrebs Stammzellen (KSZ) 15, die auf NFKB Signalgebung für das Überleben und das Wachstum 16-21 verlassen zu blockieren. Wir finden , dass die Wirksamkeit von GTCpFE gegen den NFkB Weg deutlich über ASA 15 verbessert. Darüber hinaus GTCpFE Blöcke mammosphere Bildung und dämpft die Oberflächenmarker CD44 CSC + CD24 – Immunophänotyp, was darauf hinweist , dass GTCpFE fähig ist CSCs auszurotten 15. Diese Ergebnisse stellen die Aspirin-Fumarat Prodrug als ein wirksames entzündungshemmendes Mittel, das auch Brust CSCs ausrichten können. In Bezug auf die Brustkrebstherapie kann GTCpFE das Potenzial haben, aggressive und tödliche Krankheit zu behandeln.Protocol
Representative Results
Discussion
In this protocol, we demonstrated the synthesis of an ASA prodrug, GTCpFE, where the fumarate pharmacophore was incorporated to improve the anti-NFĸB activity in breast cancer cells. GTCpFE is an effective NFĸB inhibitor, whereas ASA itself is not, even at much higher concentrations. The fumarate moiety has anti-inflammatory properties as shown by its ability to inhibit NFĸB signaling in a variety of cell lines and tissues14,25-29. The prodrug strategy described herein, is amendable to other mal…
Disclosures
The authors have nothing to disclose.
Acknowledgements
This work was supported by grants provided by the National Institutes of Health (NIH), R01 CA200669 to JF and R01 CA121107 to GRJT, and by a postdoctoral fellowship grant from Susan G. Komen for the Cure to IK (PDF12229484).
Materials
| RPMI 1640 Red Medium | Life Technologies | 11875-093 | Warm up to 37°C before use |
| IMEM | Corning | 10-024-CV | Warm up to 37°C before use |
| DMEM / F12 Medium | ThermoFisher | 21041-025 | Warm up to 37°C before use |
| MEM NEAA 10mM 100X | Life Technologies | 11140 | |
| Penicillin Streptomycin | Life Technologies | 15140-122 | |
| L-Glutamine 100X | Life Technologies | 25030-081 | |
| Insulin | Sigma-Aldrich | I-1882 | |
| Fetal Bovine Serum | Atlanta Biologicals | S11150 | |
| Trypsin 2.5% 10X | Invitrogen | 15090046 | |
| Methyl Cellulose | Sigma | M0262 | |
| B27 Supplement 50X | Gibco | 17504-044 | |
| EGF | Gibco | PHG0311L | |
| NFκB-RE Luciferase Construct | Clontech | pGL4.32 | |
| Renilla Luciferase Construct | Promega | pGL4.70 | |
| Lipofectamine 2000 | ThermoFisher | 11668-019 | |
| Dual-Luciferase Reporter Assay | Promega | 120000032 | |
| NanoDrop Spectrophotometer | ThermoFisher | ||
| Eppendorf Mastercycler | Eppendorf | ||
| StepOne Real Time PCR System | Thermo Scientific | ||
| Eclipse Microscope | Nikon | ||
| CyAn ADP Analyzer | Beckman Coulter | ||
| QCapture Software | QImaging | ||
| Summit Software | Beckman Coulter | ||
| GraphPad Software | Prism | ||
| TRIzol | ThermoFisher | 15596-018 | |
| M-MLV Reverse Transcriptase | Invitrogen | 28025-013 | |
| 100 mM dNTP Set | Invitrogen | 10297-018 | |
| Random Hexamers | Invitrogen | 48190-011 | |
| Fast SYBR Green Master Mix | ThermoFisher | 4385612 | |
| Costar 96W, ultra low attachment | Corning | 3474 | |
| HBSS, 1X | ThermoFisher | 14025134 | |
| CD44-APC conjugated antibody | BD Pharmingen | 560990 | Store at 4°C, protect from light |
| CD24-PE antibody | BD Pharmingen | 560991 | Store at 4°C, protect from light |
| Recombinant Human TNFα | Fisher | 210TA100 | |
| CCL2 Primer Forward Sequence | AGAATCACCAGCAGCAAGTGTCC | ||
| CCL2 Primer Reverse Sequence | TCCTGAACCCACTTCTGCTTGG | ||
| ICAM1 Primer Reverse Sequence | TGACGAAGCCAGAGGTCTCAG | ||
| ICAM1 Primer Forward Sequence | AGCGTCACCTTGGCTCTAGG | ||
| TNF Primer Forward Sequence | AAGGGTGACCGACTCAGCG | ||
| TNF Primer Reverse Sequence | ATCCCAAAGTAGACCTGCCCA | ||
| 36B4 Primer Forward Sequence | GTGTTCGACAATGGCAGCAT | ||
| 36B4 Primer Reverse Sequence | GACACCCTCCAGGAAGCGA | ||
| Sodium Hydroxide | Sigma-Aldrich | S5881-500G | |
| 4-Hydroxybenzyl Alcohol | Sigma-Aldrich | 20806-10G | |
| O-Acetylsalicyloyl Chloride | Sigma-Aldrich | 165190-5G | |
| Phosphorous Pentoxide | Sigma-Aldrich | 79610-100G | |
| Ethyl Fumaroyl Chloride | Sigma-Aldrich | 669695-1G | |
| Sodium Sulfate | Sigma-Aldrich | 246980-500G | |
| 4-Dimethylaminopyridine | Sigma-Aldrich | 714844-100ML | 0.5 M in tetrahydrofuran |
| Triethylamine | Sigma-Aldrich | T0886-100ML | |
| Toluene | Sigma-Aldrich | 244511-100ML | |
| Ethyl Acetate | Sigma-Aldrich | 270989-100ML | |
| Tetrahydrofuran | Sigma-Aldrich | 401757-2L | |
| 400 MHz FT NMR spectrometer | See Bruker’s Avance User’s Manual, version 000822 for details |
References
- Hanahan, D., Weinberg, R. A. Hallmarks of cancer: the next generation. Cell. 144, 646-674 (2011).
- Cuzick, J., et al. Aspirin and non-steroidal anti-inflammatory drugs for cancer prevention: an international consensus statement. Lancet Oncol. 10, 501-507 (2009).
- Terry, M. B., et al. Association of frequency and duration of aspirin use and hormone receptor status with breast cancer risk. JAMA. 291, 2433-2440 (2004).
- Wang, D., Dubois, R. N. Cyclooxygenase-2: a potential target in breast cancer. Semin Oncol. 31, 64-73 (2004).
- Howe, L. R. Inflammation and breast cancer. Cyclooxygenase/prostaglandin signaling and breast cancer. Breast Cancer Res. 9. 9, 210 (2007).
- Kopp, E., Ghosh, S. Inhibition of NF-kappa B by sodium salicylate and aspirin. Science. 265, 956-959 (1994).
- Yin, M. J., Yamamoto, Y., Gaynor, R. B. The anti-inflammatory agents aspirin and salicylate inhibit the activity of I(kappa)B kinase-beta. Nature. 396, 77-80 (1998).
- Pierce, J. W., Read, M. A., Ding, H., Luscinskas, F. W., Collins, T. Salicylates inhibit I kappa B-alpha phosphorylation, endothelial-leukocyte adhesion molecule expression, and neutrophil transmigration. J Immunol. 156, 3961-3969 (1996).
- Frasor, J., El-Shennawy, L., Stender, J. D., Kastrati, I. NFkappaB affects estrogen receptor expression and activity in breast cancer through multiple mechanisms. Mol Cell Endocrinol. 418, 235-239 (2014).
- Perkins, N. D. The diverse and complex roles of NF-kappaB subunits in cancer. Nat Rev Cancer. 12, 121-132 (2012).
- DiDonato, J. A., Mercurio, F., Karin, M. NF-kappaB and the link between inflammation and cancer. Immunol Rev. 246, 379-400 (2012).
- Scarpignato, C., Hunt, R. H. Nonsteroidal antiinflammatory drug-related injury to the gastrointestinal tract: clinical picture, pathogenesis, and prevention. Gastroenterol Clin North Am. 39, 433-464 (2010).
- Sostres, C., Gargallo, C. J. Gastrointestinal lesions and complications of low-dose aspirin in the gastrointestinal tract. Best Pract Res Clin Gastroenterol. 26, 141-151 (2012).
- Kastrati, I., et al. Dimethyl Fumarate Inhibits the Nuclear Factor kappaB Pathway in Breast Cancer Cells by Covalent Modification of p65 Protein. J Biol Chem. 291, 3639-3647 (2016).
- Kastrati, I., et al. A novel aspirin prodrug inhibits NFkappaB activity and breast cancer stem cell properties. BMC Cancer. 15, 845 (2015).
- Cao, Y., Luo, J. L., Karin, M. IkappaB kinase alpha kinase activity is required for self-renewal of ErbB2/Her2-transformed mammary tumor-initiating cells. Proc Natl Acad Sci U S A. 104, 15852-15857 (2007).
- Liu, M., et al. The canonical NF-kappaB pathway governs mammary tumorigenesis in transgenic mice and tumor stem cell expansion. Cancer Res. 70, 10464-10473 (2010).
- Korkaya, H., Liu, S., Wicha, M. S. Regulation of cancer stem cells by cytokine networks: attacking cancer’s inflammatory roots. Clin Cancer Res. 17, 6125-6129 (2011).
- Hinohara, K., et al. ErbB receptor tyrosine kinase/NF-kappaB signaling controls mammosphere formation in human breast cancer. Proc Natl Acad Sci U S A. 109, 6584-6589 (2012).
- Kendellen, M. F., Bradford, J. W., Lawrence, C. L., Clark, K. S., Baldwin, A. S. Canonical and non-canonical NF-kappaB signaling promotes breast cancer tumor-initiating cells. Oncogene. 33, 1297-1305 (2014).
- Yamamoto, M., et al. NF-kappaB non-cell-autonomously regulates cancer stem cell populations in the basal-like breast cancer subtype. Nat Commun. 4, 2299 (2013).
- Rio, D. C., Ares, M., Hannon, G. J., Nilsen, T. W. Purification of RNA using TRIzol (TRI reagent). Cold Spring Harb Protoc. , (2010).
- Frasor, J., et al. Positive cross-talk between estrogen receptor and NF-kappaB in breast cancer. Cancer Res. 69, 8918-8925 (2009).
- Al-Hajj, M., Wicha, M. S., Benito-Hernandez, A., Morrison, S. J., Clarke, M. F. Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A. 100, 3983-3988 (2003).
- Vandermeeren, M., et al. Dimethylfumarate is an inhibitor of cytokine-induced nuclear translocation of NF-kappa B1, but not RelA in normal human dermal fibroblast cells. J Invest Dermatol. 116, 124-130 (2001).
- Loewe, R., et al. Dimethylfumarate inhibits TNF-induced nuclear entry of NF-kappa B/p65 in human endothelial cells. J Immunol. 168, 4781-4787 (2002).
- Seidel, P., et al. Dimethylfumarate inhibits NF-{kappa}B function at multiple levels to limit airway smooth muscle cell cytokine secretion. Am J Physiol Lung Cell Mol Physiol. 297, L326-L339 (2009).
- Wilms, H., et al. Dimethylfumarate inhibits microglial and astrocytic inflammation by suppressing the synthesis of nitric oxide, IL-1beta, TNF-alpha and IL-6 in an in-vitro model of brain inflammation. J Neuroinflammation. 7, 30 (2010).
- Peng, H., et al. Dimethyl fumarate inhibits dendritic cell maturation via nuclear factor kappaB (NF-kappaB) and extracellular signal-regulated kinase 1 and 2 (ERK1/2) and mitogen stress-activated kinase 1 (MSK1) signaling. J Biol Chem. 287, 28017-28026 (2012).
- Li, H. J., Reinhardt, F., Herschman, H. R., Weinberg, R. A. Cancer-stimulated mesenchymal stem cells create a carcinoma stem cell niche via prostaglandin E2 signaling. Cancer Discov. 2, 840-855 (2012).
- Li, X., et al. Intrinsic resistance of tumorigenic breast cancer cells to chemotherapy. J Natl Cancer Inst. 100, 672-679 (2008).
- Diehn, M., et al. Association of reactive oxygen species levels and radioresistance in cancer stem cells. Nature. 458, 780-783 (2009).
- Hollier, B. G., Evans, K., Mani, S. A. The epithelial-to-mesenchymal transition and cancer stem cells: a coalition against cancer therapies. J Mammary Gland Biol Neoplasia. 14, 29-43 (2009).
- Velasco-Velazquez, M. A., Popov, V. M., Lisanti, M. P., Pestell, R. G. The role of breast cancer stem cells in metastasis and therapeutic implications. Am J Pathol. 179, 2-11 (2011).
- Dontu, G., et al. In vitro propagation and transcriptional profiling of human mammary stem/progenitor cells. Genes Dev. 17, 1253-1270 (2003).
- Charafe-Jauffret, E., et al. Cancer stem cells in breast: current opinion and future challenges. Pathobiology. 75, 75-84 (2008).
- Clayton, H., Titley, I., Vivanco, M. Growth and differentiation of progenitor/stem cells derived from the human mammary gland. Exp Cell Res. 297, 444-460 (2004).
- Ginestier, C., et al. ALDH1 is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome. Cell Stem Cell. 1, 555-567 (2007).
- Rosen, J. M., Jordan, C. T. The increasing complexity of the cancer stem cell paradigm. Science. 324, 1670-1673 (2009).
- Visvader, J. E., Lindeman, G. J. Cancer stem cells in solid tumours: accumulating evidence and unresolved questions. Nat Rev Cancer. 8, 755-768 (2008).
