Sistema de cultura tridimensional e livre de soro para células-tronco da glândula lacrimal
Summary
O método de cultura tridimensional e livre de soro para células-tronco da glândula lacrimal adulta (LG) está bem estabelecido para a indução da formação organoide LG e diferenciação em células acinar ou ductais.
Abstract
A terapia à base de células-tronco (LG) é uma estratégia promissora para doenças lacrimais da glândula. No entanto, a falta de um método de cultura confiável e livre de soro para obter um número suficiente de células-tronco LG (LGSCs) é um obstáculo para novas pesquisas e aplicação. O método de cultura tridimensional (3D), sem soro para LGSCs de mouse adulto é bem estabelecido e mostrado aqui. Os LGSCs poderiam ser continuamente transicionados e induzidos a diferenciar-se para células acinar ou ductais.
Para a cultura primária lgsc, os LGs de camundongos de 6-8 semanas de idade foram digeridos com despase, colagenase I, e trypsin-EDTA. Um total de 1 × 104 células individuais foram semeadas em 80 μL de matriz de células-tronco de glândula gel-lacrimal (LGSCM) em cada poço de uma placa de 24 poços, pré-revestida com 20 μL de matriz de gel-LGSCM matriz. A mistura foi solidificada após a incubação por 20 min a 37 °C, e 600 μL de LGSCM adicionado.
Para a manutenção lgsc, os LGSCs cultivados por 7 dias foram desagregados em células únicas por despase e trippsin-EDTA. As células únicas foram implantadas e cultivadas de acordo com o método utilizado na cultura primária lgsc. Os LGSCs poderiam ser passagens mais de 40 vezes e expressar continuamente marcadores de células-tronco/progenitor Krt14, Krt5, P63 e nestin. Os LGSCs cultivados no LGSCM têm capacidade de auto-renovação e podem se diferenciar em células acinar ou ductais in vitro e in vivo.
Introduction
As células-tronco da glândula lacrimal (LGSCs) mantêm a renovação celular da glândula lacrimal (LG) e são a fonte de células acinar e ductais. Portanto, o transplante LGSC é considerado uma abordagem alternativa para o tratamento de danos inflamatórios graves e doença ocular seca deficiente aquosa (ADDED)1,2,3. Vários métodos de cultura foram aplicados para enriquecer lgscs. Tiwari et al. células LG primárias separadas e cultivadas usando colágeno I e gel de matriz complementados com vários fatores de crescimento; no entanto, as células LG não poderiam ser continuamente cultivadas4. Usando cultura bidimensional (2D), as células-tronco derivadas do MOUSE LG foram isoladas por You et al.5 e Ackermann et al. 6, encontrado para expressar os genes marcadores de células-tronco/progenitor, Oct4, Sox2, Nanog e nestin, e poderia ser subcultado. No entanto, não há indicação clara de que essas células possam se diferenciar em células acinar ou ductais, e não há experimento de transplante para verificar o potencial de diferenciação in vivo.
Recentemente, as células c-kit+ dim/EpCAM+/Sca1–/CD34–/CD45- foram isoladas dos LGs do mouse por citometria de fluxo, encontradas para expressar marcadores celulares progenitores LG, como Pax6 e Runx1, e diferenciadas em dutos e acini in vitro. Em camundongos com ADICIONADO, a injeção ortotópica com essas células poderia reparar LGs danificados e restaurar a função secretary dos LGs2. No entanto, o número de células-tronco isoladas por este método foi pequeno, e não há condições de cultura adequadas para a expansão dos LGSCs isolados. Em resumo, é necessário estabelecer um sistema de cultura adequado para isolar e cultivar efetivamente LGSCs adultos com expansão estável e contínua para o estudo de LGSCs no tratamento de ADDED.
Organoides derivados de células-tronco ou células-tronco pluripotentes são um grupo de células que são histologicamente semelhantes aos órgãos relacionados e podem manter sua própria renovação. Depois que o organoide do intestino do camundongo foi cultivado com sucesso por Sato et al. em 20097, organoides de outros órgãos foram cultivados em sucessão, com base no sistema cultural de Sato, como vesículabiliar 8, fígado9, pâncreas10, estômago11, mama12, pulmão13, próstata14 e glândula salivar15 . Devido à alta proporção de células-tronco adultas antes da diferenciação celular na cultura organoide, o método de cultura organoide tridimensional (3D) é considerado ideal para o isolamento e cultura das células-tronco adultas da LG.
Um sistema de cultura LGSC de camundongos adultos foi estabelecido no presente estudo pela otimização do método de cultura 3D, livre de soro. É comprovado que os LGSCs cultivados tanto a partir de camundongos normais quanto adicionados apresentaram uma capacidade estável de autoconexão e proliferação. Após o transplante nos LGs do mouse adicionado, os LGSCs colonizaram os LGs prejudicados e melhoraram a produção de lágrimas. Além disso, os LGSCs fluorescentes vermelhos foram isolados de camundongos ROSA26mT/mG e cultivados. Este trabalho fornece uma referência confiável para o enriquecimento LGSC in vitro e autoenxerto LGSC na aplicação clínica para terapia adicional.
Protocol
Representative Results
Discussion
Existem métodos bem estabelecidos para o isolamento e cultura in vitro de células-tronco lacrimais para a cultura de células-tronco lacrimais e reparação de lesões LG. Shatos et al.17 e Ackermannet al. 6 células-tronco lacrimal cultivadas e subculturadas com sucesso de ratos e camundongos por métodos de cultura 2D, respectivamente, possibilitando o transplante de células-tronco lacrimais para o tratamento de ADDED. Estudos sobre células-tronco<su…
Disclosures
The authors have nothing to disclose.
Acknowledgements
Este trabalho foi apoiado por uma bolsa da Fundação Nacional de Ciência Natural da China (nº 31871413) e dois Programas de Ciência e Tecnologia de Guangdong (2017B020230002 e 2016B030231001). Somos verdadeiramente gratos aos pesquisadores que nos ajudaram durante o estudo e aos funcionários que trabalham no centro animal por seu apoio no cuidado com os animais.
Materials
| Animal(Mouse) | |||
| Bal B/C | Model Animal Research Center of Nanjing University | ||
| C57 BL/6J | Laboratory Animal Center of Sun Yat-sen University | ||
| NOD/ShiLtJ | Model Animal Research Center of Nanjing University | ||
| ROSA26mT/mG | Model Animal Research Center of Nanjing University | ||
| Equipment | |||
| Analytical balance | Sartorius | ||
| Automatic dehydrator | Thermo | ||
| Blood counting chamber | BLAU | ||
| Cell Counter | CountStar | ||
| CO2 constant temperature incubator | Thermo | ||
| ECL Gel imaging system | GE healthcare | ||
| Electric bath for water bath | Yiheng Technology | ||
| Electrophoresis apparatus | BioRad | ||
| Fluorescence quantitative PCR instrument | Roche | ||
| Frozen tissue slicer | Lecia | ||
| Horizontal centrifuge | CENCE | ||
| Inverted fluorescence microscope | Nikon | ||
| Inverted microscope | Olympus | ||
| Laser lamellar scanning micrograph | Carl Zeiss | ||
| Liquid nitrogen container | Thermo | ||
| Low temperature high speed centrifuge | Eppendorf | ||
| Micropipettor | Gilson | ||
| Microwave oven | Panasonic | ||
| Nanodrop ultraviolet spectrophotometer | Thermo | measure RNA concentration | |
| Paraffin slicing machine | Thermo | ||
| PCR Amplifier | Eppendorf | ||
| pH value tester | Sartorius | ||
| 4 °C Refrigerator | Haier | ||
| Thermostatic culture oscillator | ZHICHENG | ||
| Tissue paraffin embedding instrument | Thermo | ||
| -80°C Ultra-low temperature refrigerator | Thermo | ||
| -20°C Ultra-low temperature refrigerator | Thermo | ||
| Ultra pure water purification system | ELGA | ||
| Reagent | |||
| Animal Experiment | |||
| HCG | Sigma | 9002-61-3 | |
| PMSG | Sigma | 14158-65-7 | |
| Pentobarbital Sodium | Sigma | 57-33-0 | |
| Cell Culture | |||
| B27 | Gibco | 17504044 | |
| Collagenase I | Gibco | 17018029 | |
| Dispase | BD | 354235 | |
| DMEM | Sigma | D6429 | |
| DMEM/F12 | Sigma | D0697 | |
| DMSO | Sigma | 67-68-5 | |
| EDTA | Sangon Biotech | A500895 | |
| Foetal Bovine Serum | Gibco | 04-001-1ACS | |
| GlutaMax | Gibco | 35050087 | |
| Human FGF10 | PeproTech | 100-26 | |
| Matrigel (Matrix gel) | BD | 356231 | |
| Murine Noggin | PeproTech | 250-38 | |
| Murine Wnt3A | PeproTech | 315-20 | |
| Murine EGF | PeproTech | 315-09 | |
| NEAA | Gibco | 11140050 | |
| N2 | Gibco | 17502048 | |
| R-spondin 1 | PeproTech | 120-38 | |
| Trypsin Inhibitor (TI) | Sigma | T6522 | Derived from Glycine max; can inhibit trypsin, chymotrypsin, and plasminase to a lesser extent. One mg will inhibit 1.0-3.0 mg of trypsin. |
| Trypsin | Sigma | T4799 | |
| Y-27632 | Selleck | S1049 | |
| HE staining & Immunostaining | |||
| Alexa Fluor 488 donkey anti-Mouse IgG | Thermo | A-21202 | Used dilution: IHC) 2 μg/mL, (IF) 0.2 μg/mL |
| Alexa Fluor 488 donkey anti-Rabbit IgG | Thermo | A-21206 | Used dilution: (IHC) 2 μg/mL, (IF) 2 μg/mL |
| Alexa Fluor 568 donkey anti-Mouse IgG | Thermo | A-10037 | Used dilution: (IHC) 2 μg/mL, (IF) 2 μg/mL |
| Alexa Fluor 568 donkey anti-Rabbit IgG | Thermo | A-10042 | Used dilution: (IHC) 2 μg/mL, (IF) 4 μg/mL |
| Anti-AQP5 rabbit antibody | Abcam | ab104751 | Used dilution: (IHC) 1 μg/mL, (IF) 0.1 μg/mL |
| Anti-E-cadherin Rat antibody | Abcam | ab11512 | Used dilution: (IF) 5 μg/mL |
| Anti-Keratin14 rabbit antibody | Abcam | ab181595 | Used dilution: (IHC) 1 μg/mL, (IF) 2 μg/mL |
| Anti-Ki67 rabbit antibody | Abcam | ab15580 | Used dilution: (IHC) 1 μg/mL, (IF) 1 μg/mL |
| Anti-mCherry mouse antibody | Abcam | ab125096 | Used dilution: (IHC) 2 μg/mL, (IF) 2 μg/mL |
| Anti-mCherry rabbit antibody | Abcam | ab167453 | Used dilution: (IF) 2 μg/mL |
| C6H8O7 | Sangon Biotech | A501702-0500 | |
| Citric Acid | Sangon Biotech | 201-069-1 | |
| DAB Kit (20x) | CWBIO | CW0125 | |
| DAPI | Thermo | 62248 | |
| Eosin | BASO | 68115 | |
| Fluorescent Mounting Medium | Dako | S3023 | |
| Formalin | Sangon Biotech | A501912-0500 | |
| Goat anti-Mouse IgG antibody (HRP) | Abcam | ab6789 | Used dilution: 2 μg/mL |
| Goat anti-Rabbit IgG antibody(HRP) | Abcam | ab6721 | Used dilution: 2 μg/mL |
| Hematoxylin | BASO | 517-28-2 | |
| Histogel (Embedding hydrogel) | Thermo | HG-400-012 | |
| 30% H2O2 | Guangzhou Chemistry | KD10 | |
| 30% Hydrogen Peroxide Solution | Guangzhou Chemistry | 7722-84-1 | |
| Methanol | Guangzhou Chemistry | 67-56-1 | |
| Na3C6H5O7.2H2O | Sangon Biotech | A501293-0500 | |
| Neutral balsam | SHANGHAI YIYANG | YY-Neutral balsam | |
| Non-immunized Goat Serum | BOSTER | AR0009 | |
| Paraffin | Sangon Biotech | A601891-0500 | |
| Paraformaldehyde | DAMAO | 200-001-8 | |
| Saccharose | Guangzhou Chemistry | 57-50-1 | |
| Sodium citrate tribasic dihydrate | Sangon Biotech | 200-675-3 | |
| Sucrose | Guangzhou Chemistry | IB11-AR-500G | |
| Tissue-Tek O.T.C. Compound | SAKURA | SAKURA.4583 | |
| Triton X-100 | DINGGUO | 9002-93-1 | |
| Xylene | Guangzhou Chemistry | 128686-03-3 | |
| RT-PCR & qRT-PCR | |||
| Agarose | Sigma | 9012-36-6 | |
| Alcohol | Guangzhou Chemistry | 64-17-5 | |
| Chloroform | Guangzhou Chemistry | 865-49-6 | |
| Ethidium Bromide | Sangon Biotech | 214-984-6 | |
| Isopropyl Alcohol | Guangzhou Chemistry | 67-63-0 | |
| LightCycler 480 SYBR Green I Master Mix | Roche | 488735200H | |
| ReverTra Ace qPCR RT Master Mix | TOYOBO | – | |
| Taq DNA Polymerase | TAKARA | R10T1 | |
| Goldview (nucleic acid stain) | BioSharp | BS357A | |
| TRIzol | Magen | R4801-02 | |
| Vector Construction & Cell Transfection | |||
| Agar | OXID | – | |
| Ampicillin | Sigma | 69-52-3 | |
| Chloramphenicol | Sigma | 56-75-7 | |
| Endotoxin-free Plasmid Extraction Kit | Thermo | A36227 | |
| Kanamycin | Sigma | 25389-94-0 | |
| Lipo3000 Plasmid Transfection Kit | Thermo | L3000015 | |
| LR Reaction Kit | Thermo | 11791019 | |
| Plasmid Extraction Kit | TIANGEN | DP103 | |
| Trans5α Chemically Competent Cell | TRANSGEN | CD201-01 | |
| Trytone | OXID | – | |
| Yeast Extract | OXID | – | |
| Primers and Sequence | Company | ||
| Primer: AQP5 Sequence: F: CATGAACCCAGCCCGATCTT R: CTTCTGCTCCCATCCCATCC |
Synbio Tech | ||
| Primer: β-actin Sequence: F: AGATCAAGATCATTGCTCCTCCT R: AGATCAAGATCATTGCTCCTCCT |
Synbio Tech | ||
| Primer: Epcam Sequence: F: CATTTGCTCCAAACTGGCGT R: TGTCCTTGTCGGTTCTTCGG |
Synbio Tech | ||
| Primer: Krt5 Sequence: F: AGCAATGGCGTTCTGGAGG R: GCTGAAGGTCAGGTAGAGCC |
Synbio Tech | ||
| Primer: Krt14 Sequence: F: CGGACCAAGTTTGAGACGGA R: GCCACCTCCTCGTGGTTC |
Synbio Tech | ||
| Primer: Krt19 Sequence: F: TCTTTGAAAAACACTGAACCCTG R: TGGCTCCTCAGGGCAGTAAT |
Synbio Tech | ||
| Primer: Ltf Sequence: F: CACATGCTGTCGTATCCCGA R: CGATGCCCTGATGGACGA |
Synbio Tech | ||
| Primer: Nestin Sequence: F: GGGGCTACAGGAGTGGAAAC R: GACCTCTAGGGTTCCCGTCT |
Synbio Tech | ||
| Primer: P63 Sequence: F: TCCTATCACGGGAAGGCAGA R: GTACCATCGCCGTTCTTTGC |
Synbio Tech | ||
| Vector | |||
| pLX302 lentivirus no-load vector | Addgene | ||
| pENRTY-mCherry | Xiaofeng Qin laboratory, Sun Yat-sen University |
References
- Zoukhri, D., Macari, E., Kublin, C. L. A single injection of interleukin-1 induces reversible aqueous tear deficiency, lacrimal gland inflammation, and acinar and ductal cell proliferation. Experimental Eye Research. 84 (5), 894-904 (2007).
- Gromova, A., et al. Lacrimal gland repair using progenitor cells. Stem Cells Translational Medicine. 6 (1), 88-98 (2016).
- Buzhor, E., et al. Cell-based therapy approaches: the hope for incurable diseases. Regenerative Medicine. 9 (5), 649-672 (2014).
- Tiwari, S., et al. Establishing human lacrimal gland cultures with secretory function. PLoS One. 7 (1), 29458 (2012).
- You, S., Kublin, C. L., Avidan, O., Miyasaki, D., Zoukhri, D. Isolation and propagation of mesenchymal stem cells from the lacrimal gland. Investigative Ophthalmology & Visual Science. 52 (5), 2087-2094 (2011).
- Ackermann, P., et al. Isolation and investigation of presumptive murine lacrimal gland stem cells. Investigative Ophthalmology & Visual Science. 56 (8), 4350-4363 (2015).
- Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459 (7244), 262-265 (2009).
- Lugli, N., et al. R-spondin 1 and noggin facilitate expansion of resident stem cells from non-damaged gallbladders. EMBO Reports. 17 (5), 769-779 (2016).
- Huch, M., et al. Long-term culture of genome-stable bipotent stem cells from adult human liver. Cell. 160 (1), 299-312 (2015).
- Boj, S. F., et al. Organoid models of human and mouse ductal pancreatic cancer. Cell. 160 (1), 324-338 (2015).
- Barker, N., et al. Lgr5+(ve) stem cells drive self-renewal in the stomach and build long-lived gastric units in vitro. Cell Stem Cell. 6 (1), 25-36 (2010).
- Linnemann, J. R., et al. Quantification of regenerative potential in primary human mammary epithelial cells. Development. 142 (18), 3239-3251 (2015).
- Rock, J. R., et al. Basal cells as stem cells of the mouse trachea and human airway epithelium. Proceedings of the National Academy of Sciences of the United States of America. 106 (31), 12771-12775 (2009).
- Chua, C. W., et al. Single luminal epithelial progenitors can generate prostate organoids in culture. Nature Cell Biology. 16 (1), 951-961 (2014).
- Maimets, M., et al. Long-term in vitro expansion of salivary gland stem cells driven by Wnt signals. Stem Cell Reports. 6 (1), 150-162 (2016).
- Xiao, S., Zhang, Y. Establishment of long-term serum-free culture for lacrimal gland stem cells aiming at lacrimal gland repair. Stem Cell Research & Therapy. 11 (1), 20 (2020).
- Shatos, M. A., Haugaard-Kedstrom, L., Hodges, R. R., Dartt, D. A. Isolation and characterization of progenitor cells in uninjured, adult rat lacrimal gland. Investigative Ophthalmology & Visual Science. 53 (6), 2749-2759 (2012).
- Mishima, K., et al. Transplantation of side population cells restores the function of damaged exocrine glands through clusterin. Stem Cells. 30 (9), 1925-1937 (2012).
- Aluri, H. S., et al. Delivery of bone marrow-derived mesenchymal stem cells improves tear production in a mouse model of sjögren’s syndrome. Stem Cells International. 2017, 1-10 (2017).
- Dietrich, J., Schrader, S. Towards lacrimal gland regeneration: current concepts and experimental approaches. Current Eye Research. 45 (3), 230-240 (2020).
- Sato, T., Clevers, H. SnapShot: growing organoids from stem cells. Cell. 161 (7), 1700 (2015).
- Kleinman, H. K., Martin, G. R. Matrigel: basement membrane matrix with biological activity. Seminars in Cancer Biology. 15 (5), 378-386 (2005).
- Arnaoutova, I., George, J., Kleinman, H. K., Benton, G. Basement membrane matrix (BME) has multiple uses with stem cells. Stem Cell Reviews and Reports. 8 (1), 163-169 (2012).
