성체 눈물샘(LG) 줄기세포를 위한 삼차원, 무혈청 배양 방법은 LG 오가노이드 형성의 유도 및 아시나 또는 덕트 유사 세포로의 분화를 위해 잘 확립되어 있다.
눈물샘 (LG) 줄기 세포 기반 치료는 눈물샘 질환에 대한 유망한 전략입니다. 그러나, 충분한 수의 LG 줄기세포(LGSCs)를 얻기 위한 신뢰할 수 있는 무혈청 배양 방법의 결여는 추가적인 연구 및 적용을 위한 하나의 장애물이다. 성인 마우스 LGSCs에 대한 3차원(3D), 무혈청 배양 방법이 잘 확립되어 여기에 도시되어 있다. LGSCs는 지속적으로 계대되고 acinar 또는 ductal-like 세포로 분화하도록 유도될 수 있었다.
LGSC 일차 배양을 위해, 6-8주령의 마우스로부터의 LGs를 디스파제, 콜라게나제 I 및 트립신-EDTA로 소화시켰다. 총 1 × 10개의 4개의 단일 세포를24 -웰 플레이트의 각 웰에 80 μL의 매트릭스 겔-눈물샘 줄기 세포 배지 (LGSCM) 매트릭스에 시딩하고, 20 μL의 매트릭스 겔-LGSCM 매트릭스로 예비코팅하였다. 혼합물을 37°C에서 20분 동안 인큐베이션한 후, 600 μL의 LGSCM을 첨가하여 고형화시켰다.
LGSC 유지를 위해, 7일 동안 배양된 LGSCs는 디스파아제 및 트립신-EDTA에 의해 단일 세포로 분해되었다. 상기 단세포는 LGSC 일차 배양에 사용된 방법에 따라 이식 및 배양하였다. LGSC는 40 회 이상 계대되고 줄기 / 선조 세포 마커 Krt14, Krt5, P63 및 네스틴을 지속적으로 발현 할 수 있습니다. LGSCM에서 배양된 LGSCs는 자기 재생 능력을 가지며 시험관내 및 생체내에서 아시나 또는 덕트형 세포로 분화할 수 있다.
눈물샘 줄기 세포 (LGSCs)는 눈물샘 (LG) 세포 재생을 유지하며 acinar 및 ductal 세포의 원천입니다. 따라서, LGSC 이식은 심각한 염증성 손상 및 수성-결핍성 안구 건조증(ADDED)1,2,3을 치료하기 위한 대안적인 접근법으로 간주된다. LGSCs를 풍부하게하기 위해 여러 가지 배양 방법이 적용되었습니다. Tiwari et al. 여러 성장 인자가 보충 된 콜라겐 I 및 매트릭스 젤을 사용하여 일차 LG 세포를 분리 및 배양했습니다. 그러나, LG 세포는 지속적으로 배양될 수 없었다4. 2차원(2D) 배양물을 사용하여, 마우스 LG 유래 줄기세포를 You et al.5 및 Ackermann et al.에 의해 분리하였다. 도 6에 나타낸 바와 같이, 줄기/전구 세포 마커 유전자, Oct4, Sox2, Nanog 및 네스틴을 발현하는 것으로 밝혀졌으며, 계대배양될 수 있었다. 그러나, 이들 세포가 아시나 또는 덕트 세포로 분화할 수 있다는 명확한 징후는 없으며, 생체내에서 분화 가능성을 검증하기 위한 이식 실험은 없다.
최근에, c-kit+ dim/EpCAM+/Sca1–/CD34-/CD45– 세포는 유세포 분석기에 의해 마우스 LG로부터 분리되었고, Pax6 및 Runx1과 같은 LG 전구 세포 마커를 발현하는 것으로 밝혀졌으며, 시험관 내에서 덕트 및 아시니로 분화되었다. ADDED를 가진 마우스에서, 이들 세포를 이용한 동위원소 주사는 손상된 LG를 복구하고 LGs2의 분비 기능을 회복시킬 수 있다. 그러나, 이 방법에 의해 단리된 줄기세포의 수는 적었고, 단리된 LGSCs를 확장시키기 위한 적절한 배양 조건은 없었다. 요약하면, ADDED의 치료에서 LGSCs의 연구를 위해 안정적이고 지속적인 확장으로 성인 LGSCs를 효과적으로 분리하고 배양하기 위해 적절한 배양 시스템이 수립 될 필요가있다.
줄기 세포 또는 만능 줄기 세포로부터 유래 된 오가노이드는 관련 기관과 조직학적으로 유사하고 자신의 재생을 유지할 수있는 세포 그룹입니다. 마우스 장 오가노이드가 2009년Sato et al. 7에 의해 성공적으로 배양된 후, 담낭8, 간9, 췌장10, 위 11, 유방12, 폐13, 전립선14 및 타액선15와 같은 사토의 배양 시스템에 기초하여 다른 장기로부터의 오가노이드를 연속적으로 배양하였다. . 오가노이드 배양에서 세포 분화 전 성체 줄기세포의 비율이 높기 때문에, 3차원(3D) 오가노이드 배양 방법은 LG의 성체줄기세포의 분리 및 배양에 최적으로 고려된다.
성인 마우스 LGSC 배양 시스템은 3D, 무혈청 배양 방법을 최적화함으로써 본 연구에서 확립되었다. 정상 및 ADDED 마우스 둘 다로부터 배양된 LGSCs가 자가재생 및 증식의 안정한 능력을 나타냈다는 것이 입증되었다. ADDED 마우스 LGs에 이식 한 후, LGSCs는 손상된 LG를 식민지화하고 눈물 생산을 개선했습니다. 또한, 적색 형광 LGSCs를 ROSA26mT/mG 마우스로부터 분리하고 배양하였다. 이 연구는 ADDED 요법을 위한 임상 적용 에서 시험관내 LGSC 농축 및 LGSC 자가이식편에 대한 신뢰할 수 있는 참조를 제공한다.
눈물 줄기 세포 배양 및 LG 손상 복구를위한 눈물 줄기 세포의 분리 및 시험관 내 배양을위한 잘 확립 된 방법이 있습니다. Shatos et al.17 and Ackermannet al. (6) 쥐와 생쥐의 눈물 줄기세포를 각각 2D 배양 방법으로 성공적으로 배양 및 계대배양하여, ADD 치료를 위해 눈물 줄기세포를 이식할 수 있게 하였다. 2D로 배양된 LGs의 줄기세포18 및…
The authors have nothing to disclose.
이 연구는 중국 국립 자연 과학 재단 (제 31871413 호)의 보조금과 광동 과학 기술 (2017B020230002 및 2016B030231001)의 두 가지 프로그램에 의해 지원되었습니다. 우리는 연구 기간 동안 우리를 도운 연구원들과 동물 센터에서 일하는 직원들에게 동물 보호에 대한 그들의 지원에 진심으로 감사드립니다.
Animal(Mouse) | |||
Bal B/C | Model Animal Research Center of Nanjing University | ||
C57 BL/6J | Laboratory Animal Center of Sun Yat-sen University | ||
NOD/ShiLtJ | Model Animal Research Center of Nanjing University | ||
ROSA26mT/mG | Model Animal Research Center of Nanjing University | ||
Equipment | |||
Analytical balance | Sartorius | ||
Automatic dehydrator | Thermo | ||
Blood counting chamber | BLAU | ||
Cell Counter | CountStar | ||
CO2 constant temperature incubator | Thermo | ||
ECL Gel imaging system | GE healthcare | ||
Electric bath for water bath | Yiheng Technology | ||
Electrophoresis apparatus | BioRad | ||
Fluorescence quantitative PCR instrument | Roche | ||
Frozen tissue slicer | Lecia | ||
Horizontal centrifuge | CENCE | ||
Inverted fluorescence microscope | Nikon | ||
Inverted microscope | Olympus | ||
Laser lamellar scanning micrograph | Carl Zeiss | ||
Liquid nitrogen container | Thermo | ||
Low temperature high speed centrifuge | Eppendorf | ||
Micropipettor | Gilson | ||
Microwave oven | Panasonic | ||
Nanodrop ultraviolet spectrophotometer | Thermo | measure RNA concentration | |
Paraffin slicing machine | Thermo | ||
PCR Amplifier | Eppendorf | ||
pH value tester | Sartorius | ||
4 °C Refrigerator | Haier | ||
Thermostatic culture oscillator | ZHICHENG | ||
Tissue paraffin embedding instrument | Thermo | ||
-80°C Ultra-low temperature refrigerator | Thermo | ||
-20°C Ultra-low temperature refrigerator | Thermo | ||
Ultra pure water purification system | ELGA | ||
Reagent | |||
Animal Experiment | |||
HCG | Sigma | 9002-61-3 | |
PMSG | Sigma | 14158-65-7 | |
Pentobarbital Sodium | Sigma | 57-33-0 | |
Cell Culture | |||
B27 | Gibco | 17504044 | |
Collagenase I | Gibco | 17018029 | |
Dispase | BD | 354235 | |
DMEM | Sigma | D6429 | |
DMEM/F12 | Sigma | D0697 | |
DMSO | Sigma | 67-68-5 | |
EDTA | Sangon Biotech | A500895 | |
Foetal Bovine Serum | Gibco | 04-001-1ACS | |
GlutaMax | Gibco | 35050087 | |
Human FGF10 | PeproTech | 100-26 | |
Matrigel (Matrix gel) | BD | 356231 | |
Murine Noggin | PeproTech | 250-38 | |
Murine Wnt3A | PeproTech | 315-20 | |
Murine EGF | PeproTech | 315-09 | |
NEAA | Gibco | 11140050 | |
N2 | Gibco | 17502048 | |
R-spondin 1 | PeproTech | 120-38 | |
Trypsin Inhibitor (TI) | Sigma | T6522 | Derived from Glycine max; can inhibit trypsin, chymotrypsin, and plasminase to a lesser extent. One mg will inhibit 1.0-3.0 mg of trypsin. |
Trypsin | Sigma | T4799 | |
Y-27632 | Selleck | S1049 | |
HE staining & Immunostaining | |||
Alexa Fluor 488 donkey anti-Mouse IgG | Thermo | A-21202 | Used dilution: IHC) 2 μg/mL, (IF) 0.2 μg/mL |
Alexa Fluor 488 donkey anti-Rabbit IgG | Thermo | A-21206 | Used dilution: (IHC) 2 μg/mL, (IF) 2 μg/mL |
Alexa Fluor 568 donkey anti-Mouse IgG | Thermo | A-10037 | Used dilution: (IHC) 2 μg/mL, (IF) 2 μg/mL |
Alexa Fluor 568 donkey anti-Rabbit IgG | Thermo | A-10042 | Used dilution: (IHC) 2 μg/mL, (IF) 4 μg/mL |
Anti-AQP5 rabbit antibody | Abcam | ab104751 | Used dilution: (IHC) 1 μg/mL, (IF) 0.1 μg/mL |
Anti-E-cadherin Rat antibody | Abcam | ab11512 | Used dilution: (IF) 5 μg/mL |
Anti-Keratin14 rabbit antibody | Abcam | ab181595 | Used dilution: (IHC) 1 μg/mL, (IF) 2 μg/mL |
Anti-Ki67 rabbit antibody | Abcam | ab15580 | Used dilution: (IHC) 1 μg/mL, (IF) 1 μg/mL |
Anti-mCherry mouse antibody | Abcam | ab125096 | Used dilution: (IHC) 2 μg/mL, (IF) 2 μg/mL |
Anti-mCherry rabbit antibody | Abcam | ab167453 | Used dilution: (IF) 2 μg/mL |
C6H8O7 | Sangon Biotech | A501702-0500 | |
Citric Acid | Sangon Biotech | 201-069-1 | |
DAB Kit (20x) | CWBIO | CW0125 | |
DAPI | Thermo | 62248 | |
Eosin | BASO | 68115 | |
Fluorescent Mounting Medium | Dako | S3023 | |
Formalin | Sangon Biotech | A501912-0500 | |
Goat anti-Mouse IgG antibody (HRP) | Abcam | ab6789 | Used dilution: 2 μg/mL |
Goat anti-Rabbit IgG antibody(HRP) | Abcam | ab6721 | Used dilution: 2 μg/mL |
Hematoxylin | BASO | 517-28-2 | |
Histogel (Embedding hydrogel) | Thermo | HG-400-012 | |
30% H2O2 | Guangzhou Chemistry | KD10 | |
30% Hydrogen Peroxide Solution | Guangzhou Chemistry | 7722-84-1 | |
Methanol | Guangzhou Chemistry | 67-56-1 | |
Na3C6H5O7.2H2O | Sangon Biotech | A501293-0500 | |
Neutral balsam | SHANGHAI YIYANG | YY-Neutral balsam | |
Non-immunized Goat Serum | BOSTER | AR0009 | |
Paraffin | Sangon Biotech | A601891-0500 | |
Paraformaldehyde | DAMAO | 200-001-8 | |
Saccharose | Guangzhou Chemistry | 57-50-1 | |
Sodium citrate tribasic dihydrate | Sangon Biotech | 200-675-3 | |
Sucrose | Guangzhou Chemistry | IB11-AR-500G | |
Tissue-Tek O.T.C. Compound | SAKURA | SAKURA.4583 | |
Triton X-100 | DINGGUO | 9002-93-1 | |
Xylene | Guangzhou Chemistry | 128686-03-3 | |
RT-PCR & qRT-PCR | |||
Agarose | Sigma | 9012-36-6 | |
Alcohol | Guangzhou Chemistry | 64-17-5 | |
Chloroform | Guangzhou Chemistry | 865-49-6 | |
Ethidium Bromide | Sangon Biotech | 214-984-6 | |
Isopropyl Alcohol | Guangzhou Chemistry | 67-63-0 | |
LightCycler 480 SYBR Green I Master Mix | Roche | 488735200H | |
ReverTra Ace qPCR RT Master Mix | TOYOBO | – | |
Taq DNA Polymerase | TAKARA | R10T1 | |
Goldview (nucleic acid stain) | BioSharp | BS357A | |
TRIzol | Magen | R4801-02 | |
Vector Construction & Cell Transfection | |||
Agar | OXID | – | |
Ampicillin | Sigma | 69-52-3 | |
Chloramphenicol | Sigma | 56-75-7 | |
Endotoxin-free Plasmid Extraction Kit | Thermo | A36227 | |
Kanamycin | Sigma | 25389-94-0 | |
Lipo3000 Plasmid Transfection Kit | Thermo | L3000015 | |
LR Reaction Kit | Thermo | 11791019 | |
Plasmid Extraction Kit | TIANGEN | DP103 | |
Trans5α Chemically Competent Cell | TRANSGEN | CD201-01 | |
Trytone | OXID | – | |
Yeast Extract | OXID | – | |
Primers and Sequence | Company | ||
Primer: AQP5 Sequence: F: CATGAACCCAGCCCGATCTT R: CTTCTGCTCCCATCCCATCC |
Synbio Tech | ||
Primer: β-actin Sequence: F: AGATCAAGATCATTGCTCCTCCT R: AGATCAAGATCATTGCTCCTCCT |
Synbio Tech | ||
Primer: Epcam Sequence: F: CATTTGCTCCAAACTGGCGT R: TGTCCTTGTCGGTTCTTCGG |
Synbio Tech | ||
Primer: Krt5 Sequence: F: AGCAATGGCGTTCTGGAGG R: GCTGAAGGTCAGGTAGAGCC |
Synbio Tech | ||
Primer: Krt14 Sequence: F: CGGACCAAGTTTGAGACGGA R: GCCACCTCCTCGTGGTTC |
Synbio Tech | ||
Primer: Krt19 Sequence: F: TCTTTGAAAAACACTGAACCCTG R: TGGCTCCTCAGGGCAGTAAT |
Synbio Tech | ||
Primer: Ltf Sequence: F: CACATGCTGTCGTATCCCGA R: CGATGCCCTGATGGACGA |
Synbio Tech | ||
Primer: Nestin Sequence: F: GGGGCTACAGGAGTGGAAAC R: GACCTCTAGGGTTCCCGTCT |
Synbio Tech | ||
Primer: P63 Sequence: F: TCCTATCACGGGAAGGCAGA R: GTACCATCGCCGTTCTTTGC |
Synbio Tech | ||
Vector | |||
pLX302 lentivirus no-load vector | Addgene | ||
pENRTY-mCherry | Xiaofeng Qin laboratory, Sun Yat-sen University |