שיטת התרבית התלת-ממדית, ללא סרום, לתאי גזע של בלוטת דמעה בוגרת (LG) מבוססת היטב על אינדוקציה של היווצרות והתמיינות של אורגנואידים LG לתאים דמויי אצינר או צינור.
טיפול מבוסס תאי גזע בבלוטת הדמעות (LG) הוא אסטרטגיה מבטיחה למחלות בלוטות הדמעות. עם זאת, היעדרה של שיטת תרבית אמינה ונטולת סרום להשגת מספר מספיק של תאי גזע LG (LGSCs) הוא מכשול אחד למחקר ויישום נוספים. שיטת התרבות התלת-ממדית (התלת-ממדית) ללא סרום עבור LGSCs של עכברים בוגרים מבוססת היטב ומוצגת כאן. ניתן היה להעביר את ה-LGSCs באופן רציף ולגרום להם להתמיין לתאים דמויי אצינר או דמויי צינור.
עבור התרבות העיקרית של LGSC, LGs מעכברים בני 6-8 שבועות עוכלו עם דיספנס, קולגן I וטריפסין-EDTA. בסך הכל 1 × 104 תאים בודדים נזרעו לתוך 80 μL של מטריצה ג’ל-בלוטת דמעה של מטריצה בלוטת גזע בינונית (LGSCM) בכל באר של צלחת 24 בארות, מצופה מראש עם 20 μL של מטריצה ג’ל-LGSCM מטריצה. התערובת התמצקה לאחר הדגירה במשך 20 דקות בטמפרטורה של 37 מעלות צלזיוס, ו-600 μL של LGSCM נוספו.
לצורך תחזוקת LGSC, LGSCs בתרבית במשך 7 ימים פורקו לתאים בודדים על ידי פירוק וטריפסין-EDTA. התאים הבודדים הושתלו ותרבית על פי השיטה ששימשה בתרבית הראשונית של LGSC. LGSCs יכולים לעבור למעלה מ-40 פעמים ולבטא באופן רציף סמני תאי גזע/אב Krt14, Krt5, P63 ונסטין. LGSCs בתרבית LGSCM הם בעלי יכולת התחדשות עצמית ויכולים להתמיין לתאים דמויי אצינר או צינור במבחנה וב-in vivo.
תאי גזע של בלוטת הדמעות (LGSCs) שומרים על התחדשות תאי בלוטת הדמעות (LG) והם המקור לתאי אצינר ותאים דוקטליים. לכן, השתלת LGSC נחשבת לגישה חלופית לטיפול בנזק דלקתי חמור ובמחלת עיניים יבשות עם מחסור מימי (ADDED)1,2,3. מספר שיטות תרבית יושמו כדי להעשיר את הלהט”בים. Tiwari et al. הפרידו ותרבית תאי LG ראשוניים בתרבית באמצעות קולגן I וג’ל מטריקס בתוספת מספר גורמי גדילה; עם זאת, תאי LG לא יכלו להיות בתרבית רציפה4. באמצעות תרבית דו-ממדית (דו-ממדית), תאי גזע שמקורם בעכבר LG בודדו על ידי You et al.5 ו-Ackermann et al. 6, שנמצא כמבטא את הגנים של סמן תאי גזע/אב, Oct4, Sox2, Nanog ו-nestin, וניתן היה לתת-תרבות. עם זאת, אין אינדיקציה ברורה לכך שתאים אלה יכולים להתמיין לתאי אצינר או צינור, ואין ניסוי השתלה כדי לאמת את פוטנציאל ההתמיינות in vivo.
לאחרונה, תאי c-kit+ dim/EpCAM+/Sca1–/CD34-/CD45– בודדו מתאי LGs של עכברים על ידי ציטומטריית זרימה, נמצאו כמבטאים סמני תאי אב LG, כגון Pax6 ו-Runx1, והתמיינו לתעלות ואצ’יני במבחנה. בעכברים עם ADDED, הזרקה אורתוטופית עם תאים אלה יכולה לתקן LGs פגומים ולשחזר את תפקוד ההפרשה של LGs2. עם זאת, מספר תאי הגזע שבודדו בשיטה זו היה קטן, ואין תנאי תרבית מתאימים להרחבת הלהט”בים המבודדים. לסיכום, יש להקים מערכת תרביות מתאימה כדי לבודד ולתרבות ביעילות LGSCs בוגרים עם התרחבות יציבה ומתמשכת לחקר LGSCs בטיפול ב- ADDED.
אורגנואידים המופקים מתאי גזע או מתאי גזע פלוריפוטנטיים הם קבוצה של תאים הדומים מבחינה היסטולוגית לאיברים הקשורים ויכולים לשמור על התחדשות משלהם. לאחר שהאורגנואיד של מעי העכבר תרבית בהצלחה על ידי Sato et al. בשנת 20097, אורגנואידים מאיברים אחרים הועתקו ברצף, בהתבסס על מערכת התרבית של סאטו, כגון כיס המרה8, כבד9, לבלב10, קיבה11, שד12, ריאה13, ערמונית14 ובלוטת הרוק15 . בשל השיעור הגבוה של תאי גזע בוגרים לפני התמיינות תאים בתרבית אורגנואידים, שיטת תרבית האורגנואידים התלת-ממדית (3D) נחשבת אופטימלית לבידוד ולתרבית של תאי גזע בוגרים של LG.
מערכת תרבית LGSC של עכבר בוגר הוקמה במחקר הנוכחי על ידי אופטימיזציה של שיטת התרבות התלת-ממדית, ללא סרום. הוכח כי הלהט”בים שעברו תרבית הן מעכברים רגילים והן מעכברים שנוספו הראו יכולת יציבה של התחדשות עצמית והתפשטות. לאחר השתלה ב-LGs של העכברים הנוספו, LGSCs התיישבו ב-LGs הפגומים ושיפרו את ייצור הקרעים. בנוסף, LGSCs פלואורסצנטיים אדומים בודדו מעכברי ROSA26mT/mG ועברו תרבית. עבודה זו מספקת התייחסות אמינה להעשרת LGSC במבחנה ול- LGSC autograft ביישום קליני לטיפול נוסף.
ישנן שיטות מבוססות היטב לבידוד ותרבית חוץ גופית של תאי גזע דמעתיים לתרבית תאי גזע דמעה ותיקון פציעת LG. Shatos et al.17 ו- Ackermannet al. 6 תאי גזע דמע תת-תרבותיים בתרבית ותת-תרבותית של חולדות ועכברים בהצלחה בשיטות תרבית דו-ממדיות, בהתאמה, מה שמאפשר להשתיל תאי גזע דמעות…
The authors have nothing to disclose.
עבודה זו נתמכה על ידי מענק מהקרן הלאומית למדעי הטבע של סין (מס ‘31871413) ושתי תוכניות של מדע וטכנולוגיה של גואנגדונג (2017B020230002 ו- 2016B030231001). אנו אסירי תודה לחוקרים שעזרו לנו במהלך המחקר ולאנשי הצוות העובדים במרכז לבעלי החיים על תמיכתם בטיפול בבעלי חיים.
Animal(Mouse) | |||
Bal B/C | Model Animal Research Center of Nanjing University | ||
C57 BL/6J | Laboratory Animal Center of Sun Yat-sen University | ||
NOD/ShiLtJ | Model Animal Research Center of Nanjing University | ||
ROSA26mT/mG | Model Animal Research Center of Nanjing University | ||
Equipment | |||
Analytical balance | Sartorius | ||
Automatic dehydrator | Thermo | ||
Blood counting chamber | BLAU | ||
Cell Counter | CountStar | ||
CO2 constant temperature incubator | Thermo | ||
ECL Gel imaging system | GE healthcare | ||
Electric bath for water bath | Yiheng Technology | ||
Electrophoresis apparatus | BioRad | ||
Fluorescence quantitative PCR instrument | Roche | ||
Frozen tissue slicer | Lecia | ||
Horizontal centrifuge | CENCE | ||
Inverted fluorescence microscope | Nikon | ||
Inverted microscope | Olympus | ||
Laser lamellar scanning micrograph | Carl Zeiss | ||
Liquid nitrogen container | Thermo | ||
Low temperature high speed centrifuge | Eppendorf | ||
Micropipettor | Gilson | ||
Microwave oven | Panasonic | ||
Nanodrop ultraviolet spectrophotometer | Thermo | measure RNA concentration | |
Paraffin slicing machine | Thermo | ||
PCR Amplifier | Eppendorf | ||
pH value tester | Sartorius | ||
4 °C Refrigerator | Haier | ||
Thermostatic culture oscillator | ZHICHENG | ||
Tissue paraffin embedding instrument | Thermo | ||
-80°C Ultra-low temperature refrigerator | Thermo | ||
-20°C Ultra-low temperature refrigerator | Thermo | ||
Ultra pure water purification system | ELGA | ||
Reagent | |||
Animal Experiment | |||
HCG | Sigma | 9002-61-3 | |
PMSG | Sigma | 14158-65-7 | |
Pentobarbital Sodium | Sigma | 57-33-0 | |
Cell Culture | |||
B27 | Gibco | 17504044 | |
Collagenase I | Gibco | 17018029 | |
Dispase | BD | 354235 | |
DMEM | Sigma | D6429 | |
DMEM/F12 | Sigma | D0697 | |
DMSO | Sigma | 67-68-5 | |
EDTA | Sangon Biotech | A500895 | |
Foetal Bovine Serum | Gibco | 04-001-1ACS | |
GlutaMax | Gibco | 35050087 | |
Human FGF10 | PeproTech | 100-26 | |
Matrigel (Matrix gel) | BD | 356231 | |
Murine Noggin | PeproTech | 250-38 | |
Murine Wnt3A | PeproTech | 315-20 | |
Murine EGF | PeproTech | 315-09 | |
NEAA | Gibco | 11140050 | |
N2 | Gibco | 17502048 | |
R-spondin 1 | PeproTech | 120-38 | |
Trypsin Inhibitor (TI) | Sigma | T6522 | Derived from Glycine max; can inhibit trypsin, chymotrypsin, and plasminase to a lesser extent. One mg will inhibit 1.0-3.0 mg of trypsin. |
Trypsin | Sigma | T4799 | |
Y-27632 | Selleck | S1049 | |
HE staining & Immunostaining | |||
Alexa Fluor 488 donkey anti-Mouse IgG | Thermo | A-21202 | Used dilution: IHC) 2 μg/mL, (IF) 0.2 μg/mL |
Alexa Fluor 488 donkey anti-Rabbit IgG | Thermo | A-21206 | Used dilution: (IHC) 2 μg/mL, (IF) 2 μg/mL |
Alexa Fluor 568 donkey anti-Mouse IgG | Thermo | A-10037 | Used dilution: (IHC) 2 μg/mL, (IF) 2 μg/mL |
Alexa Fluor 568 donkey anti-Rabbit IgG | Thermo | A-10042 | Used dilution: (IHC) 2 μg/mL, (IF) 4 μg/mL |
Anti-AQP5 rabbit antibody | Abcam | ab104751 | Used dilution: (IHC) 1 μg/mL, (IF) 0.1 μg/mL |
Anti-E-cadherin Rat antibody | Abcam | ab11512 | Used dilution: (IF) 5 μg/mL |
Anti-Keratin14 rabbit antibody | Abcam | ab181595 | Used dilution: (IHC) 1 μg/mL, (IF) 2 μg/mL |
Anti-Ki67 rabbit antibody | Abcam | ab15580 | Used dilution: (IHC) 1 μg/mL, (IF) 1 μg/mL |
Anti-mCherry mouse antibody | Abcam | ab125096 | Used dilution: (IHC) 2 μg/mL, (IF) 2 μg/mL |
Anti-mCherry rabbit antibody | Abcam | ab167453 | Used dilution: (IF) 2 μg/mL |
C6H8O7 | Sangon Biotech | A501702-0500 | |
Citric Acid | Sangon Biotech | 201-069-1 | |
DAB Kit (20x) | CWBIO | CW0125 | |
DAPI | Thermo | 62248 | |
Eosin | BASO | 68115 | |
Fluorescent Mounting Medium | Dako | S3023 | |
Formalin | Sangon Biotech | A501912-0500 | |
Goat anti-Mouse IgG antibody (HRP) | Abcam | ab6789 | Used dilution: 2 μg/mL |
Goat anti-Rabbit IgG antibody(HRP) | Abcam | ab6721 | Used dilution: 2 μg/mL |
Hematoxylin | BASO | 517-28-2 | |
Histogel (Embedding hydrogel) | Thermo | HG-400-012 | |
30% H2O2 | Guangzhou Chemistry | KD10 | |
30% Hydrogen Peroxide Solution | Guangzhou Chemistry | 7722-84-1 | |
Methanol | Guangzhou Chemistry | 67-56-1 | |
Na3C6H5O7.2H2O | Sangon Biotech | A501293-0500 | |
Neutral balsam | SHANGHAI YIYANG | YY-Neutral balsam | |
Non-immunized Goat Serum | BOSTER | AR0009 | |
Paraffin | Sangon Biotech | A601891-0500 | |
Paraformaldehyde | DAMAO | 200-001-8 | |
Saccharose | Guangzhou Chemistry | 57-50-1 | |
Sodium citrate tribasic dihydrate | Sangon Biotech | 200-675-3 | |
Sucrose | Guangzhou Chemistry | IB11-AR-500G | |
Tissue-Tek O.T.C. Compound | SAKURA | SAKURA.4583 | |
Triton X-100 | DINGGUO | 9002-93-1 | |
Xylene | Guangzhou Chemistry | 128686-03-3 | |
RT-PCR & qRT-PCR | |||
Agarose | Sigma | 9012-36-6 | |
Alcohol | Guangzhou Chemistry | 64-17-5 | |
Chloroform | Guangzhou Chemistry | 865-49-6 | |
Ethidium Bromide | Sangon Biotech | 214-984-6 | |
Isopropyl Alcohol | Guangzhou Chemistry | 67-63-0 | |
LightCycler 480 SYBR Green I Master Mix | Roche | 488735200H | |
ReverTra Ace qPCR RT Master Mix | TOYOBO | – | |
Taq DNA Polymerase | TAKARA | R10T1 | |
Goldview (nucleic acid stain) | BioSharp | BS357A | |
TRIzol | Magen | R4801-02 | |
Vector Construction & Cell Transfection | |||
Agar | OXID | – | |
Ampicillin | Sigma | 69-52-3 | |
Chloramphenicol | Sigma | 56-75-7 | |
Endotoxin-free Plasmid Extraction Kit | Thermo | A36227 | |
Kanamycin | Sigma | 25389-94-0 | |
Lipo3000 Plasmid Transfection Kit | Thermo | L3000015 | |
LR Reaction Kit | Thermo | 11791019 | |
Plasmid Extraction Kit | TIANGEN | DP103 | |
Trans5α Chemically Competent Cell | TRANSGEN | CD201-01 | |
Trytone | OXID | – | |
Yeast Extract | OXID | – | |
Primers and Sequence | Company | ||
Primer: AQP5 Sequence: F: CATGAACCCAGCCCGATCTT R: CTTCTGCTCCCATCCCATCC |
Synbio Tech | ||
Primer: β-actin Sequence: F: AGATCAAGATCATTGCTCCTCCT R: AGATCAAGATCATTGCTCCTCCT |
Synbio Tech | ||
Primer: Epcam Sequence: F: CATTTGCTCCAAACTGGCGT R: TGTCCTTGTCGGTTCTTCGG |
Synbio Tech | ||
Primer: Krt5 Sequence: F: AGCAATGGCGTTCTGGAGG R: GCTGAAGGTCAGGTAGAGCC |
Synbio Tech | ||
Primer: Krt14 Sequence: F: CGGACCAAGTTTGAGACGGA R: GCCACCTCCTCGTGGTTC |
Synbio Tech | ||
Primer: Krt19 Sequence: F: TCTTTGAAAAACACTGAACCCTG R: TGGCTCCTCAGGGCAGTAAT |
Synbio Tech | ||
Primer: Ltf Sequence: F: CACATGCTGTCGTATCCCGA R: CGATGCCCTGATGGACGA |
Synbio Tech | ||
Primer: Nestin Sequence: F: GGGGCTACAGGAGTGGAAAC R: GACCTCTAGGGTTCCCGTCT |
Synbio Tech | ||
Primer: P63 Sequence: F: TCCTATCACGGGAAGGCAGA R: GTACCATCGCCGTTCTTTGC |
Synbio Tech | ||
Vector | |||
pLX302 lentivirus no-load vector | Addgene | ||
pENRTY-mCherry | Xiaofeng Qin laboratory, Sun Yat-sen University |