This protocol serves as a scheme for setting up a functional Tet-ON system in cancer cell lines and its subsequent use, in particular for studying the role of tumor cell-derived proteins in recruitment of monocytes/macrophages to the tumor microenvironment.
siRNA and shRNA-mediated knock down (KD) methods of regulating gene expression are invaluable tools for understanding gene and protein function. However, in the case that the KD of the protein of interest has a lethal effect on cells or the anticipated effect of the KD is time-dependent, unconditional KD methods are not appropriate. Conditional systems are more suitable in these cases and have been the subject of much interest. These include Ecdysone-inducible overexpression systems, Cytochrome P-450 induction system1, and the tetracycline regulated gene expression systems.
The tetracycline regulated gene expression system enables reversible control over protein expression by induction of shRNA expression in the presence of tetracycline. In this protocol, we present an experimental design using functional Tet-ON system in human cancer cell lines for conditional regulation of gene expression. We then demonstrate the use of this system in the study of tumor cell-monocyte interaction.
Tumor associated macrophages (TAMs) contribute to tumor development by promoting tumor growth, metastasis, and regulating the immune response2. Cancer cells recruit inflammatory monocytes, which infiltrate tumor and differentiate into pro-tumorigenic TAMs3. Infiltration of the tumor with TAMs correlates with poor clinical outcome and has been linked to the immunosuppressive role of macrophages4,5. However, the mechanisms of the recruitment of macrophages to the tumor are not well explored and a better understanding of the involved pathways is crucial for further advancement of the field and promising therapies. One of the challenges in studying interactions between tumor cells and normal cells in the tumor microenvironment (TME) is the complexity of the mechanisms and cells involved, requiring in vitro approaches that allow dissection of the crosstalk. Here we present a versatile methodology that can be applied to study the paracrine effect of a cancer cell-derived, secreted protein on migration of other cell types like macrophages, in vitro. Using a system where the expression of the shRNA against a cancer cell-derived protein involved in the recruitment of monocytes is under the control of the tetracycline inducible promoter, the paracrine effect of the secreted protein on monocytes is quantitated. In this protocol, cloning of shRNA sequences into the tetracycline regulated vector is presented followed by generation of stable cancer cell lines. Further, the purification of primary human monocytes and a Boyden chamber assay are used to analyze the paracrine effect of a cancer-cell derived protein on migration of monocytes.
Downregulation of protein coding genes is commonly applied with siRNA and shRNA techniques, though not without limitations in its use. The long-term knock-down (KD) of genes may elicit secondary adaptive responses of cells that interfere with experimental results. Lack of temporal control over gene expression makes it challenging to study the dynamic role of a protein over time or the role of a protein crucial for cell survival. This issue is especially important in in vivo settings, where the role of a protein in tumor development and progression might require downregulation of the expression of the protein of interest only after tumor is established. Conditional KD has the advantage of preventing a too early lethal effect of the KD on cells, and to enable analysis of the role of the protein within different stages of tumor growth, while unconditional KD could result in lack of tumor development.
A number of conditional KD systems have been developed to address the limitations of stable KD. The conditional gene expression systems include Ecdysone-inducible overexpression systems, the Cytochrome P-450 induction system1, and tetracycline regulated gene expression systems. The tetracycline-regulated gene expression systems allow control over expression of the shRNA upon addition of the antibiotic tetracycline (or its more stable analogue – doxycycline). In Tet-ON systems, the expression of shRNA is induced in the presence of tetracycline/doxycycline resulting in a gene expression KD, while in Tet-OFF systems, the expression of shRNA is suppressed in the presence of tetracycline resulting in gene expression. A drawback of tetracycline-inducible system is previously reported low levels of expression of shRNA in the absence of doxycycline – so-called leakiness6,7. In the Tet-ON system described here, upon administration of tetracycline, the binding of constitutively expressed tetracycline repressor (TetR) protein to the Tet-responsive element (TRE) sequence within the H1 promoter region of the shRNA of interest is suppressed. This results in expression of shRNA and inhibition of translation of the protein of interest in a tetracycline-dependent manner8,9.
Other available Tet-ON systems include simultaneous knock-in of the TetO sequence between TATA box and proximal sequence element (PSE) and between TATA box and transcription start site developed by Chan et al.10 This system requires less than toxic doses of tetracycline to regulate shRNA expression, however, under a non-induced state, low levels of shRNA are expressed. The Krüppel-associated box (KRAB) based Tet-ON system11 includes KRAB, a zinc finger protein, which subjects genes located within a 3 kb range of the KRAB binding site to transcriptional suppression. The chimeric protein tTRKRAB can bind to TetO, and due to the large-range of DNA controllable capacity, TetO do not need to be limited between the transcription start site and the promoter and have low impact on the activity of the promoter. Under the non-induced state, this controllable RNA interference system was reported to show a lower level of leaked expression of shRNA11,12; however, it requires a sequential, two-vector cloning approach. In comparison to previously developed conditional KD systems such as the Ecdysone-inducible overexpression system or Cytochrome P-450 induction system, the tetracycline-regulated system has the advantage of its robustness and reversibility, and therefore is the most routinely used system13. The system used in this protocol has the advantage over the dual TetO knock-in system and KRAB Tet-ON system as it requires straight forward, single vector cloning, allowing quick generation of multiple clones, and it exhibits very low levels of leakiness in the absence of doxycycline.
TME is critical for the development of cancer. To facilitate tumor growth, cancer cells recruit inflammatory monocytes by secreting chemotactic proteins. Recruited monocytes infiltrate the tumor and differentiate into pro-tumorigenic TAMs that contribute to tumor growth and metastasis. In vitro studies of the immune cell recruitment utilize migration assays, with Boyden chamber assay being widely used14,15,16,17. In this assay, the chemoattractant protein source, for example, cancer cells, or a purified protein, is placed in the bottom chamber. Immune cells are placed in the upper chamber separated with porous membrane from the bottom compartment. Cells migrating toward the increasing gradient of chemoattractant, and those found on the lower side of the membrane are stained and counted under the microscope. Here we test the chemoattractant function of Plasminogen Activator Inhibitor 1 (PAI-1) on monocytes by generating stable, inducible cancer cell lines where expression of PAI-1 is regulated by doxycycline addition. We use human primary monocytes in the Boyden chamber migration assay to assess the role of PAI-1 in monocyte migration. Differences between human primary monocytes and widely used monocytic cell lines like THP1 have been reported and include different cytokine expression patterns18; for example, 5 – 10 fold increase in TNF-α expression levels by THP1 cells compared to human monocytes19. THP1 cells are derived from human leukemia monocytic cells, are easy to maintain, and proliferate with an average doubling time of 19 – 50 h20. On the contrary, human monocytes are characterized by a short lifespan in the absence of growth factors. Since monocytes are purified from blood of donors, a fair amount of variability occurs among the individuals and depending on the purification method, contamination with other cell types may occur. Nevertheless, primary monocytes are relevant and it has been recommended to use or confirm the results obtained with the monocytic cell lines using primary monocytes in biological research19. Here we describe a protocol for purification of human primary monocytes from peripheral blood. Alternative methods of monocyte purification include density gradient and adhesion protocols and two step procedure with single gradients of Ficoll-Hypaque followed by a Percoll gradient21. The purity of the monocyte population obtained by those methods ranges between 70 – 90%. The method described here uses a density gradient followed by a negative immune selection22 and enables the purification of human monocytes without direct contact with antibodies, thereby avoiding their accidental activation and resulting in a >95% pure population of monocytes.
The protocol presented here is used for setting up a functional Tet-ON system for gene expression KD in human cancer cell lines to study the chemoattractant effect of the cancer-derived secreted protein PAI-1 on monocytes. PAI-1 is overexpressed by a variety of tumors and its expression paradoxically correlates with poor clinical outcome23,24. The pro-tumorigenic role of PAI-1 is a result of its pro-angiogenic and anti-apoptotic functions25,26. PAI-1 has been shown to contribute to inflammation by promoting the recruitment of macrophages to the site of inflammation27. PAI-1 was shown to promote smooth muscle cellmigration28,29 and to participate in the Mac-1 dependent macrophage migration30. PAI-1 overexpression has been also shown to significantly enhance the recruitment of Raw 264.7 macrophages into B16F10 melanoma tumors31. However, the role of PAI-1 in TAM migration has not been investigated in detail. We use the described protocol to answer the question of whether PAI-1 attracts monocytes to cancer cells. This methodology allows dissection of the crosstalk between tumor and TME by silencing the secreted protein in cancer cells and analyzing the components of the TME.
The protocol section that uses human monocytes obtained from healthy volunteers follows the guidelines of the Children's Hospital Los Angeles Human Research Ethics Committee and has been approved by the Institutional Review Board under the Human Material Protocol number: CCI 08-00208.
1. Preparation of Cancer Cell Lines with Tetracycline-regulated shRNA Expression
2. Isolation of Monocytes from Human Blood
3. Boyden Chamber Migration Assay
Three shRNA sequences were tested for the most efficient KD of PAI-1. For this, shRNA sequences against PAI-1 and scrambled (Table 1) were cloned into Tet-pLKO-puro expression vector following the protocol described above. The HT-1080 fibrosarcoma cell line was stably transfected with generated constructs and the cells were treated with doxycycline for 3 days. The expression of PAI-1 was verified by Western blotting (Figure 2A) and the intensity of the bands corresponding to PAI-1 and tubulin was analyzed by densitometry. Using the most effective KD sequence (shRNA 2), we additionally generated MDA-MB-231 epithelial breast adenocarcinoma cells (Figure 2B) and HCT116 colorectal carcinoma cells (Figure 2C) stably transfected with a tetracycline-regulated pLKO-shRNA2-PAI-1 expression vector (and shRNA scrambled as a control). We achieved a 74% decrease of PAI-1 expression in MDA-MB-231 cell line (Figure 2B) and 17.5% decrease in HCT116 cell line in the presence of doxycycline (1 µg/mL)(Figure 2C) as assessed by Western blotting and densitometric analysis of the bands. The Boyden chamber assay was used to quantify the migration of monocytes towards cancer cells. We hypothesized that cancer cell-derived PAI-1 promotes the migration of monocytes towards tumor cells, and therefore less migration will be observed when PAI-1 is downregulated by the addition of doxycycline. Cancer cells were treated with doxycycline for 3 days and were seeded in the bottom of a 24-well plate at 40,000 cells/well. Purified primary human monocytes were applied in the top chamber of the assay and after 24 h, the monocytes attached to the bottom of the membrane were stained and counted under the microscope. We demonstrate that in the absence of doxycycline and therefore the presence of PAI-1, in MDA-MB-231 and HCT116 cells (both PAI-1 shRNA and scrambled controls), significantly increased the migration of human monocytes (Figure 3). The migration of monocytes was then inhibited by 33% and 74% when doxycycline was added to the co-cultures and the production of PAI-1 by tumor cells was down-regulated (Figure 3A, C). No inhibition of monocyte migration was observed with tumor cells transduced with the scrambled shRNA controls, which also indicated that doxycycline had no inhibitory effect on monocyte migration. Similar results were obtained when the conditioned medium of doxycycline-treated cancer cells was placed in the bottom of the wells as a source of chemoattractants (Figure 3B, D).
Figure 1. XhoI restriction analysis of DNA extracted from 16 bacterial colonies. DNA was extracted from 16 bacterial colonies and subjected to restriction reaction with XhoI enzyme. The resulting DNA fragments were analyzed by agarose gel electrophoresis. Positive clones (lanes 3, 8, and 11) that lack the 2 kb fragment after XhoI restriction digest are marked with arrows. Please click here to view a larger version of this figure.
Figure 2. Conditional KD of PAI-1 expression in cancer cell lines. Western blotting analysis of PAI-1 expression in cell lines stably transfected with tetracycline-regulated pLKO-shRNA-PAI-1 (shRNA 1-3) and scrambled expression vector after 3 days of doxycycline treatment. (A) HT1080. (B) MDA-MB-231. (C) HCT116. Densitometry analysis of the bands is indicated below the lanes of the Western blots as a ratio of the PAI-1 intensity over the tubulin band intensity. Please click here to view a larger version of this figure.
Figure 3. PAI-1 promotes macrophage migration. Migration of human monocytes towards (A) MDA-MB-231 and (C) HCT116 cell lines stably transfected with vector conditionally expressing shRNA 2 against PAI-1 and scrambled shRNA, measured using the Boyden chamber assay. Cancer cells were treated with doxycycline for 3 days and seeded in a 24-well plate in triplicate. Human primary monocytes were applied on the top of the insert. After 24 h, monocytes on the lower side of the filter were stained and counted under the microscope. Migration of human monocytes toward conditioned medium generated over 72 h by (B) MDA-MB-231 and (D) HCT116 cell lines conditionally expressing PAI-1 in the presence and absence of doxycycline. The data represent the mean of technical triplicates [+/- standard deviation (SD)]. For each replicate, migrated monocytes were counted in 9 fields at 20X objective magnification. Please click here to view a larger version of this figure.
Name of the Oligo | Sequence | ||||
shRNA 1 (anti PAI-1 sequence 1 – 8 ) | Forward: | shPAI-1A5' CCGGCTGACTTCACGAGTCTTTCCTCGAGGAAAGACTCGTGAAGTCAGTTTTT 3' | |||
Reverse: | shPAI-1B 5' AATTAAAAACTGACTTCACGAGTCTTTCCTCGAGGAAAGACTCGTGAAGTCAG 3' | ||||
shRNA 2: (anti PAI-1 sequence 2) | Forward: | shPAI-1C 5'-CCGGCAGACAGTTTCAGGCTGACTTCTCGAGAAGTCAGCCTGAAACTGTCTGTTTTT-3' | |||
Reverse: | shPAI-1D 5'-AATTAAAAACAGACAGTTTCAGGCTGACTTCTCGAGAAGTCAGCCTGAAACTGTCTG-3' | ||||
shRNA 3 (anti PAI-1 sequence – 3 9) | Forward: | shPAI-1E 5’-CCGGAAGGATGAGATCAGCACCACACTCGAGTGTGGTGCTGATCTCATCCTTTTTTT-3’ | |||
Reverse: | shPAI-1F 5’-AATTAAAAAAAGGATGAGATCAGCACCACACTCGAGTGTGGTGCTGATCTCATCCTT-3’ | ||||
Scramble (scramble sequence – 4 9) | Forward: | Scramble 1 5’- CCGGAATTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAATTTTTTT-3’ | |||
Reverse: | Scramble 2 5’-AATTAAAAAAATTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAATT-3’ |
Table 1. shRNA sequences. Here 3 shRNA sequences against PAI-1 were tested for the strongest silencing effect: shRNA 1, shRNA 2, shRNA 3, and scrambled
Composed of a variety of cell types, the TME is crucial for the development of cancer. To ascertain optimal growth conditions, cancer cells attract monocytes through secretion of chemotactic factors. Here we present a protocol for studying the mechanism of monocyte recruitment by tumor cells in vitro. For this purpose, a combination of inducible gene expression system, purification of primary human monocytes, and as an example of a migration assay, the Boyden chamber assay, is used.
The first critical step in the presented protocol is to confirm the correct cloning of the shRNA sequences into the Tet-ON vector, which should always be evaluated by sequencing. Further establishment of the functional stable Tet-ON cell lines needs to be confirmed by testing the KD in the presence of doxycycline by Western blotting. The amount of applied doxycycline may vary between cell lines, and therefore it is advisable to test the effective concentrations for KD and for toxicity on the cells. A known disadvantage of tetracycline-inducible systems is their leakiness6,7. The amount of protein detected in the presence and absence of doxycycline must be measured and compared to the scrambled controls to account for this effect. In the in vitro experiments, a low level of leakiness is observed with the shRNA2 and shRNA3 KD, as is shown in Figure 2. Additionally, it is important to always use tetracycline-free serum in vitro to avoid downregulation of protein levels in control conditions. The system used in this protocol has advantages over other Tet-ON systems as it requires a single vector cloning, allows quick generation of multiple clones, and exhibits very low levels of leakiness.
A critical step in obtaining primary human monocytes from blood is obtaining good gradient separation, which relies on slow layering of the diluted blood over the density gradient. Another crucial step of the protocol is to properly estimate the number of cells before the negative selection step because it will determine the amount of antibody cocktail and magnetic beads added to the blood suspension. To insure the reproducibility of experiments, more than one blood donor should be used in performing replicate experiments. This technique is superior to existing alternatives of monocyte purification including a density gradient and adhesion-based protocol34 and a two-step procedure with single gradients21, because it warrants low lymphocyte contamination level and high purity (>95%) of obtained monocytes. Since the non-monocytic cell types are removed from PBMC mixture by negative selection, monocytes do not come in direct contact with antibodies present in the antibody cocktail, and therefore the risk of monocytes becoming activated by interaction with antibodies is minimal. Alternative applications of obtained cells may include differentiation of monocytes into macrophages through in vitro and in vivo experiments where human monocytes are injected into immunodeficient mice. Modifications of the protocol commonly include use of the red blood cell lysis buffer during the washing steps of PBMCs. This modification aims at additional removal of red blood cells by applying osmotic pressure. Limitations of the technique include a limited number of macrophages that can be obtained using a specified amount of the reagents.
The Boyden chamber migration assay is a fast and straightforward way to analyze if a secreted protein or a cell line stimulates migration of other cell types. The pitfalls of this assay include low sensitivity and not accounting for cells undergoing cell death. The ways to address those concerns would be confirming the results with a different assay like a microfluidic based assay and a time-course experiment where migration is measured over shorter periods of time. Except for small populations, mature monocytes do not proliferate in vivo35,36; however if other cells are used, a timeline shorter than their division cycle should be chosen to avoid an increase in number of cells. Alternatively, reagents blocking cell division should be used to avoid changing the originally plated cell number.
The protocol presented here can be easily adapted to studies of other proteins secreted by cancer cells and their paracrine functions. One of the possible applications of conditional KD cancer cell lines is studying the role of proteins whose KD is toxic for cells not only in vitro but also in vivo, where Tet-regulated cell lines are xenotransplanted into mice, and the KD is induced after establishment of the tumor by the addition of doxycycline to the drinking water.
The authors have nothing to disclose.
The authors would like to acknowledge Jacqueline Rosenberg for proofreading the manuscript. This work was supported by the US Department of Health and Human Services/National Institutes of Health with a grant to YA DeClerck (grant 5R01 CA 129377) and the TJ Martell Foundation. MH Kubala is the recipient of a Research Career Development Fellowship award of The Saban Research Institute at Children’s Hospital Los Angeles.
Tet-pLKO-puro lentiviral vector | Addgene | 21915 | |
FBS (Tetracycline-free) | Omega Scientific | FB-15 | |
Histopaque | Sigma | 10771-500ML | |
EasySep Human Monocyte Enrichment Kit | StemCell | 19059 | |
EasySep Magnet | StemCell | 18002 | |
EcoRI HF | NEB | R3101S | |
AgeI HF | NEB | R3552S | |
Cut Smart buffer | NEB | B7200S | |
EndoFree Plasmid Maxi Kit | Qiagen | 12362 | |
PROMEGA Wizard SV Gel and PCR Cleanup System | PROMEGA | A9281 | |
psPAX vector | Addgene | 12260 | |
pMD2.G vector | Addgene | 12259 | |
One Shot Stbl3 Chemically Competent E. coli | Thermo Fisher Scientific | C737303 | |
Hema 3 stain set for Wright-Giemsa stain | Protocol | 123-869 | |
HEK293 cells | ATCC | CRL-1573 | |
PBS | Corning | 21-031-CV | |
XhoI restriction enzyme | NEB | R0146S | |
Ligase | NEB | M0202S | |
Ligase buffer | NEB | M0202S | |
EDTA 0.5 M solution | Thermo Fisher Scientific | R1021 | |
Lipofectamine 2000 | Invitrogen | 11668019 | |
The Big Easy" EasySep Magnet | Stem Cell | 18001 | |
0.1% Poly-L-Lysine solution | Sigma-Aldrich | P8920 | |
Sodium Acetate | Sigma-Aldrich | S7670 | |
Sodium butyrate | Sigma-Aldrich | B5887 | |
0.45 μM syringe filters | VWR International | 28145-479 | |
NaOH | Sigma-Aldrich | S5881-500g | |
Tris(hydroxymethyl)aminomethane (Tris) | Invitrogen | 15504-020 | |
Sodium Chloride(NaCl) | Sigma-Aldrich | S7653-5 kg | |
Magnesium Chloride (MgCl2) | Sigma-Aldrich | M8266-100g | |
dithioerythritol (DTE) | Sigma-Aldrich | B8255-5g | |
ethanol (EtOH) | Sigma-Aldrich | 792780 | |
tryptone | Amresco | J859-500g | |
yeast extract | Fluka | 70161-500g | |
Bacto agar | BD | 214010 | |
ampicillin | Sigma-Aldrich | A9393-5g | |
Dulbecco’s Modified Eagle’s Medium (DMEM) | Corning | 10-013-CV | |
phosphate-buffered saline (PBS) | Corning | 21-031-CV | |
4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) | Sigma-Aldrich | H3375 | |
puromycin | Sigma-Aldrich | P9620 | |
Doxycycline hyclate | Sigma-Aldrich | D9891-25g | |
Roswell Park Memorial Institute (RPMI) | Corning | 10-040-CV | |
0.5 M EDTA pH 8.0 | Thermo Fisher Scientific | R1021 | |
Falcon Permeable Support for 24 Well Plate with 8.0μm Transparent PET Membrane | Becton Dickinson | 353097 | |
Bovine Serum Albumin | Sigma-Aldrich | A7906 | |
Cotton-Tipped Applicator | Medline | MDS202000 | |
Protocol Hema 3 STAT pack | Fisher Scientific Company | 123-869 | |
Resolve Immersion Oil, High Viscosity | Richard Allan Scientific | M4004 | |
Penicillin Streptomycin | Gibco | 15140122 |