여기에서는 시험관 내에서 미세소관 다발을 재구성하고 동시 광학 트래핑 및 전반사 형광 현미경을 사용하여 그 안에 가해지는 힘을 직접 정량화하는 프로토콜을 제시합니다. 이 분석은 활성 미세소관 네트워크 내에서 단백질 앙상블에 의해 생성된 힘과 변위의 나노스케일 수준 측정을 허용합니다.
미세소관 네트워크는 소포 수송을 위한 트랙 역할을 하는 것부터 유사분열 동안 염색체 분리를 조절하기 위한 특수 어레이로 작동하는 것까지 광범위한 작업을 수행하기 위해 세포에 사용됩니다. 미세소관과 상호작용하는 단백질에는 활성력과 방향 운동을 생성할 수 있는 키네신 및 다인(dynein)과 같은 모터뿐만 아니라 필라멘트를 고차 네트워크로 가교결합하거나 필라멘트 역학을 조절하는 비모터 단백질이 포함됩니다. 현재까지 미세소관 관련 단백질에 대한 생물물리학적 연구는 소포 수송에 필요한 단일 운동 단백질의 역할에 압도적으로 초점을 맞추었으며, 키네신 및 다인인의 힘 생성 특성 및 기계화학적 조절을 밝히는 데 상당한 진전이 있었습니다. 그러나 유사분열 방추 내에서 필라멘트가 미끄러지는 동안과 같이 미세소관이 화물과 트랙 모두에서 작용하는 공정의 경우 관련된 가교 단백질 앙상블의 생물물리학적 조절에 대해서는 훨씬 덜 이해됩니다. 여기에서는 정제된 미세소관과 유사분열 단백질로 구성된 가교 미세소관 최소 네트워크 내에서 힘 생성 및 반응을 직접 프로빙하는 방법론에 대해 자세히 설명합니다. 미세소관 쌍은 관심 단백질에 의해 가교되고, 하나의 미세소관은 현미경 커버슬립에 고정되고, 두 번째 미세소관은 광학 트랩에 의해 조작됩니다. 동시 전반사 형광 현미경을 사용하면 필라멘트가 떨어져 힘을 생성할 때 이 미세소관 네트워크의 모든 구성 요소를 다채널 시각화할 수 있습니다. 또한 이러한 기술을 사용하여 키네신-5 앙상블이 가하는 미는 힘을 조사하는 방법과 유사분열 MAP PRC1에 의해 가교된 슬라이딩 미세소관 쌍 사이에서 점성 제동력이 어떻게 발생하는지 보여줍니다. 이러한 분석은 스핀들 조립 및 기능의 메커니즘에 대한 통찰력을 제공하며 뉴런 및 극성 상피 세포의 축삭 및 수상 돌기와 같은 다양한 맥락에서 조밀 한 미세 소관 네트워크 역학을 연구하는 데 더 광범위하게 적용될 수 있습니다.
세포는 미세소관 네트워크를 사용하여 소포 수송 1,2,3에서 유사분열 4,5,6 동안 염색체 분리에 이르기까지 다양한 기계적 작업을 수행합니다. 분자 운동 단백질 키네신 및 다인(dynein)과 같이 미세소관과 상호 작용하는 많은 단백질은 힘을 생성하고 기계적 부하에 의해 조절됩니다. 이러한 중요한 분자가 어떻게 기능하는지 더 잘 이해하기 위해 연구자들은 광학 트래핑 및 TIRF 현미경과 같은 단일 분자 생물 물리학 적 방법을 사용하여 무부하 스테핑 속도, 처리 성 및 개별 단백질에 대한 힘-속도 관계와 같은 중요한 매개 변수를 직접 모니터링했습니다. 가장 일반적으로 사용되는 실험 기하학은 구형 기하학과 크기가 모터 구동 수송을 받는 소포를 모방한 트래핑 비드에 모터 단백질을 직접 부착하는 것이었습니다. 키네신 -1 7,8,9, 키네신 -2 10,11,12, 키네 신 -313,14,15,16 키네신 -517,18, 키네 신 –8 19,20, 다인 및 다인 복합체21,22, 23,24,25, 이러한 방법으로 연구되었습니다.
그러나 많은 세포 과정에서 운동 및 비 운동 단백질은 트랙 및화물26,27로 미세 소관을 사용합니다. 또한, 미세 소관 필라멘트가 고차 다발로 가교 결합되는 이러한 시나리오에서 이러한 단백질은 단일 단위가 아닌 앙상블로 기능합니다. 예를 들어, 분열하는 체세포 내에서, 조밀한 필라멘트 네트워크는 유사분열 방추 장치(28,29,30)를 구축하기 위해 자기 조직화된다. 극간 스핀들 미세 소관 네트워크는 매우 역동적이며 스핀들 극을 가리키는 마이너스 엔드와 스핀들 적도 근처에서 겹치는 플러스 엔드로 크게 배열됩니다. 스핀들 내의 필라멘트는 운동 단백질, 예컨대 키네신-5 31,32,33, 키네신-12 34,35,36 및 키네신-1437,38,39 또는 PRC140,41,42,43 또는 NuMA 44,45와 같은 비-운동 단백질에 의해 가교되고, 46. 그들은 극 플럭스와 같은 과정에서 또는 중기 동안 염색체 중심을 조정하는 동안 또는 아나 페이즈 47,48,49,50,51,52 동안 염색체 분리를 조정하는 동안 자주 움직이거나 기계적 스트레스를 경험합니다. 따라서 유사 분열을 통한 미크론 규모의 스핀들 장치의 무결성은이 상호 작용하는 필라멘트 네트워크에 의해 생성되고 유지되는 밀고 당기는 힘의 신중하게 조절 된 균형에 의존합니다. 그러나 이 기계적 조절을 조사하고 단백질 앙상블이 어떻게 함께 작동하여 미세소관 운동을 조정하고 스핀들을 적절하게 조립하는 데 필요한 힘을 생성하는지 설명하는 데 필요한 도구는 최근에야 개발되었으며 동적 미세소관 네트워크를 정의하는 생물물리학적 규칙을 이해하기 시작했습니다.
이 원고의 목표는 시험관 내에서 가교결합된 미세소관 쌍을 재구성하고, 미세소 관과 가교 단백질의 동시 형광 시각화 및 나노스케일 힘 측정을 허용하는 현미경 챔버에서 이러한 번들을 고정하고, 이러한 데이터를 강력하게 처리하는 데 필요한 단계를 시연하는 것입니다. 형광 표지 미세소관을 안정적으로 중합하고, 부착용 현미경 커버슬립을 준비하고, 광학 트래핑 실험을 위한 폴리스티렌 비드를 준비하고, 직접적인 생물물리학적 조작을 허용하면서 생체 내 기능을 보존하는 가교 필라멘트 네트워크를 조립하는 데 필요한 단계를 자세히 설명합니다.
미세소관 네트워크는 본질적으로 근본적으로 기계적인 광범위한 작업을 수행하기 위해 무수한 세포 유형에 사용됩니다. 세포가 건강한 상태와 질병 상태 모두에서 어떻게 기능하는지 설명하려면 이러한 미크론 규모의 네트워크가 집합적으로 구축하는 나노미터 크기의 단백질에 의해 어떻게 구성되고 조절되는지 이해하는 것이 중요합니다. 광학 핀셋과 같은 생물물리학적 도구는 이 규모에서 ?…
The authors have nothing to disclose.
저자는 R21 AG067436 (JP 및 SF), T32 AG057464 (ET) 및 Rensselaer Polytechnic Institute School of Science Startup Funds (SF)의 지원을 인정하고자합니다.
10W Ytterbium Fiber Laser, 1064nm | IPG Photonics | YLR-10-1064-LP | |
405/488/561/640nm Laser Quad Band Set for TIRF applications | Chroma | TRF89901v2 | |
6x His Tag Antibody, Biotin Conjugate | Invitrogen | #MA1-21315-BTIN | |
Acetone, HPLC grade | Fisher Scientific | 18-608-395 | |
Alpha casein from bovine milk | Sigma | 1002484390 | |
ATP | Fisher Scientific | BP413-25 | |
Benzonase | Novagen | 70746-3 | |
Biotin-PEG-SVA-5000 | Laysan Bio, Inc. | NC0479433 | |
BL21 (DE3) Rosetta Cells | Millipore Sigma | 71-400-3 | |
Catalase | MP Biomedicals LLC | 190311 | |
CFI Apo 100X/1.49NA oil immersion TIRF objective | Nikon | N/A | |
Chloramphenicol | ACROS Organics | 227920250 | |
Coverslip Mini-Rack, for 8 coverslips | Fisher Scientific | C14784 | |
Delicate Task Wipers | Kimberly-Clark | 34120 | |
Dextrose Anhydrous | Fisher Scientific | BP3501 | |
D-Sucrose | Fisher Scientific | BP220-1 | |
DTT | Fisher Scientific | BP172-25 | |
Ecoline Immersion Thermostat E100 with 003 Bath | LAUDA-Brinkmann | 27709 | |
EDTA | Fisher Scientific | BP118-500 | |
EGTA | Millipore Corporation | 32462-25GM | |
FIJI / Image J | https://fiji.sc/ | N/A | |
Frosted Microscope Slides | Corning | 12-553-10 | 75mmx25mm, with thickness of 0.9-1.1mm |
Glucose Oxidase | MP Biomedicals LLC | 195196 | Type VII, without added oxygen |
GMPCPP | Jena Biosciences | JBS-NU-405S | Can be stored for several months at -20 °C and up to a year at -80 °C |
Gold Seal-Cover Glass | Thermo Scientific | 3405 | |
HEPES | Fisher Scientific | BP310-500 | |
Imidazole | Fisher Scientific | 03196-500 | |
IPTG | Fisher Scientific | BP1755-10 | |
Laboratory dessicator | Bel-Art | 999320237 | 190mm plate size |
Kanamycin Sulfate | Fischer Scientific | BP906-5 | |
KIF5A K439 (aa:1-439)-6His | Gilbert Lab, RPI | N/A | doi.org/10.1074/jbc.RA118.002182 |
Kimwipe | Kimberley Clark | Z188956 | lint-free tissue |
Immersion Oil, Type B | Cargille | 16484 | |
Lens Tissue | ThorLabs | MC-5 | |
LuNA Laser launch (4 channel: 405, 488, 561, 640nm) | Nikon | N/A | |
Lysozyme | MP Biomedicals LLC | 100834 | |
Magnesium Acetate Tetrahydrate | Fisher Scientific | BP215-500 | |
Microfuge 18 | Beckman Coulter | 367160 | |
MPEG-SVA MW-5000 | Laysan Bio, Inc. | NC0107576 | |
Neutravadin | Invitrogen | PI31000 | |
Nikon Ti-E inverted microscope | Nikon | N/A | Nikon LuN4 Laser |
Ni-NTA Resin | Thermo Scientific | 88221 | |
Oligonucleotide – CACCTATTCTGAGTTTGCGCGA GAACTTTCAAAGGC |
IDT | N/A | |
Oligonucleotide – GCCTTTGAAAGTTCTCGCGCAA ACTCAGAATAGGTG |
IDT | N/A | |
Open-top thickwall polycarbonate tube, 0.2 mL, 7 mm x 22 mm | Beckman Coulter | 343755 | |
Optima-TLX Ultracentrifuge | Beckman Coulter | 361544 | |
Paclitaxel (Taxol equivalent) | Thermo Fisher Scientific | P3456 | |
PIPES | ACROS Organics | 172615000 | |
PMSF | Millipore | 7110-5GM | |
Porcine Tubulin, biotin label | Cytoskeleton, Inc. | T333P | |
Porcine Tubulin, HiLyte 647 Fluor | Cytoskeleton, Inc. | TL670M | far red labelled |
Porcine Tubulin, Rhodamine | Cytoskeleton, Inc. | TL590M | |
Porcine Tubulin, Tubulin Protein | Cytoskeleton, Inc. | T240 | |
Potassium Acetate | Fisher Scientific | BP364-500 | |
Prime 95B sCMOS camera | Photometric | N/A | |
Quadrant Detector Sensor Head | ThorLabs | PDQ80A | |
Quikchange Lightning Kit | Agilent Technologies | 210518 | |
Sodium Bicarbonate | Fisher Scientific | S233-500 | |
Sodium Phosphate Dibasic Anhydrous | Fisher Scientific | BP332-500 | |
Square Cover Glasses | Corning | 12-553-450 | 18 mm x 18 mm, with thickness of 0.13-0.17 mm |
Streptavidin Microspheres | Polysciences Inc. | 24162-1 | |
Superose-6 Column | GE Healthcare | 29-0915–96 | |
TCEP | Thermo Scientific | 77720 | |
TLA-100 Fixed-Angle Rotor | Beckman Coulter | 343840 | |
Ultrasonic Cleaner (Sonicator) | Vevor | JPS-08A(DD) | 304 stainless steel, 40 kHz frequency, 60 W power |
Vectabond APTES solution | Vector Laboratories | SP-1800-7 | |
Windex Powerized Glass Cleaner with Ammonia-D | S.C. Johnson | SJN695237 |