Hier presenteren we een protocol voor het reconstitueren van microtubulibundels in vitro en het direct kwantificeren van de krachten die erin worden uitgeoefend met behulp van gelijktijdige optische vangmethoden en totale interne reflectiefluorescentiemicroscopie. Deze test maakt het mogelijk om op nanoschaal de krachten en verplaatsingen te meten die worden gegenereerd door eiwitensembles binnen actieve microtubulinetwerken.
Microtubule-netwerken worden in cellen gebruikt om een breed scala aan taken uit te voeren, variërend van het fungeren als sporen voor blaasjestransport tot het werken als gespecialiseerde arrays tijdens mitose om chromosoomsegregatie te reguleren. Eiwitten die interageren met microtubuli omvatten motoren zoals kinesines en dyneïne, die actieve krachten en directionele beweging kunnen genereren, evenals niet-motorische eiwitten die filamenten kruisen in netwerken van hogere orde of de filamentdynamica reguleren. Tot op heden hebben biofysische studies van microtubule-geassocieerde eiwitten zich overweldigend gericht op de rol van enkelvoudige motoreiwitten die nodig zijn voor vesikeltransport, en er is aanzienlijke vooruitgang geboekt bij het ophelderen van de krachtgenererende eigenschappen en mechanochemische regulatie van kinesines en dyneinen. Voor processen waarbij microtubuli zowel als lading als spoor fungeren, zoals tijdens het glijden van filamenten in de mitotische spil, wordt echter veel minder begrepen over de biofysische regulatie van ensembles van de betrokken crosslinking-eiwitten. Hier beschrijven we onze methodologie voor het direct onderzoeken van krachtgeneratie en respons binnen crosslinked microtubule minimale netwerken gereconstitueerd uit gezuiverde microtubuli en mitotische eiwitten. Microtubule-paren worden gekruist door eiwitten van belang, één microtubuli wordt geïmmobiliseerd tot een microscoopdeksel en de tweede microtubuli worden gemanipuleerd door een optische val. Gelijktijdige totale interne reflectie fluorescentiemicroscopie maakt meerkanaals visualisatie van alle componenten van dit microtubulinetwerk mogelijk terwijl de filamenten uit elkaar glijden om kracht te genereren. We laten ook zien hoe deze technieken kunnen worden gebruikt om duwkrachten van kinesine-5 ensembles te onderzoeken en hoe viskeuze remkrachten ontstaan tussen glijdende microtubuliparen die door de mitotische MAP PRC1 worden gekruist. Deze testen bieden inzicht in de mechanismen van spindelassemblage en -functie en kunnen breder worden aangepast om dichte microtubule-netwerkmechanica in verschillende contexten te bestuderen, zoals het axon en dendrieten van neuronen en polaire epitheelcellen.
Cellen maken gebruik van microtubule-netwerken om een breed scala aan mechanische taken uit te voeren, variërend van blaasjestransport 1,2,3 tot chromosoomsegregatie tijdens mitose 4,5,6. Veel van de eiwitten die interageren met microtubuli, zoals de moleculaire motoreiwitten kinesine en dyneïne, genereren krachten en worden gereguleerd door mechanische belastingen. Om beter te begrijpen hoe deze kritieke moleculen functioneren, hebben onderzoekers biofysische methoden met één molecuul gebruikt, zoals optische vangst en TIRF-microscopie, om kritieke parameters zoals onbelaste stapsnelheden, processiviteit en krachtsnelheidsrelaties voor individuele eiwitten direct te controleren. De meest gebruikte experimentele geometrie is geweest om motoreiwitten rechtstreeks aan vangkralen te bevestigen waarvan de bolvormige geometrie en grootte blaasjes nabootsen die motorisch transport ondergaan. Talrijke kinesines, waaronder kinesine-1 7,8,9, kinesine-2 10,11,12, kinesine-3 13,14,15,16 kinesine-5 17,18, kinesine-819,20, evenals dyneïne- en dyneïnecomplexen21,22, 23,24,25, zijn bestudeerd met deze methoden.
In veel cellulaire processen gebruiken motorische en niet-motorische eiwitten echter microtubuli zowel als spoor en lading 26,27. Bovendien, in deze scenario’s waarin microtubule filamenten worden gekruist in bundels van hogere orde, functioneren deze eiwitten als ensembles in plaats van enkele eenheden. Binnen delende somatische cellen organiseren dichte filamentnetwerken zich bijvoorbeeld zelf om het mitotische spindelapparaat 28,29,30 te bouwen. Het interpolaire spindelmicrotubulinetwerk is zeer dynamisch en is grotendeels gerangschikt met min-uiteinden die naar de spindelpolen wijzen en pluseinden die overlappen in de buurt van de spindelequator. Filamenten in de spil worden verknoopt door motoreiwitten zoals kinesine-5 31,32,33, kinesine-12 34,35,36 en kinesine-14 37,38,39, of door niet-motorische eiwitten zoals PRC1 40,41,42,43 of NuMA44,45, 46. Ze bewegen vaak of ervaren mechanische stress tijdens processen zoals poolwaartse flux of tijdens het coördineren van chromosoomcentrering tijdens metafase of chromosoomsegregatie tijdens anafase 47,48,49,50,51,52. De integriteit van het spindelapparaat op micronschaal door mitose is daarom afhankelijk van een zorgvuldig gereguleerde balans van duw- en trekkrachten die worden gegenereerd en ondersteund door dit netwerk van interagerende filamenten. De hulpmiddelen die nodig zijn om deze mechanische regulatie te onderzoeken en uit te leggen hoe eiwitensembles samenwerken om microtubulibewegingen te coördineren en de krachten te produceren die nodig zijn om de spindel goed te assembleren, zijn echter pas onlangs ontwikkeld en we beginnen nog maar net de biofysische regels te begrijpen die dynamische microtubule-netwerken definiëren.
Het doel van dit manuscript is om de stappen te demonstreren die nodig zijn om crosslinked microtubule-paren in vitro te reconstrueren, deze bundels te immobiliseren in een microscopiekamer die gelijktijdige fluorescentievisualisatie van zowel de microtubuli als crosslinking-eiwitten en nanoschaalkrachtmeting mogelijk maakt, en deze gegevens robuust te verwerken. We beschrijven de stappen die nodig zijn om fluorescentie-gelabelde microtubuli stabiel te polymeriseren, microscoop coverslips voor bevestiging voor te bereiden, polystyreenparels voor optische vangexperimenten voor te bereiden en verknoopte filamentnetwerken samen te stellen die hun in vivo functionaliteit behouden terwijl directe biofysische manipulatie mogelijk is.
Microtubule-netwerken worden gebruikt door talloze celtypen om een breed scala aan taken uit te voeren die fundamenteel mechanisch van aard zijn. Om te beschrijven hoe cellen functioneren in zowel gezonde als ziektetoestanden, is het van cruciaal belang om te begrijpen hoe deze netwerken op micronschaal worden georganiseerd en gereguleerd door de eiwitten ter grootte van een nanometer die ze gezamenlijk bouwen. Biofysische hulpmiddelen zoals een optisch pincet zijn zeer geschikt om de mechanochemie van belangrijke eiwitt…
The authors have nothing to disclose.
De auteurs willen steun erkennen van R21 AG067436 (naar JP en SF), T32 AG057464 (naar ET) en Rensselaer Polytechnic Institute School of Science Startup Funds (naar SF).
10W Ytterbium Fiber Laser, 1064nm | IPG Photonics | YLR-10-1064-LP | |
405/488/561/640nm Laser Quad Band Set for TIRF applications | Chroma | TRF89901v2 | |
6x His Tag Antibody, Biotin Conjugate | Invitrogen | #MA1-21315-BTIN | |
Acetone, HPLC grade | Fisher Scientific | 18-608-395 | |
Alpha casein from bovine milk | Sigma | 1002484390 | |
ATP | Fisher Scientific | BP413-25 | |
Benzonase | Novagen | 70746-3 | |
Biotin-PEG-SVA-5000 | Laysan Bio, Inc. | NC0479433 | |
BL21 (DE3) Rosetta Cells | Millipore Sigma | 71-400-3 | |
Catalase | MP Biomedicals LLC | 190311 | |
CFI Apo 100X/1.49NA oil immersion TIRF objective | Nikon | N/A | |
Chloramphenicol | ACROS Organics | 227920250 | |
Coverslip Mini-Rack, for 8 coverslips | Fisher Scientific | C14784 | |
Delicate Task Wipers | Kimberly-Clark | 34120 | |
Dextrose Anhydrous | Fisher Scientific | BP3501 | |
D-Sucrose | Fisher Scientific | BP220-1 | |
DTT | Fisher Scientific | BP172-25 | |
Ecoline Immersion Thermostat E100 with 003 Bath | LAUDA-Brinkmann | 27709 | |
EDTA | Fisher Scientific | BP118-500 | |
EGTA | Millipore Corporation | 32462-25GM | |
FIJI / Image J | https://fiji.sc/ | N/A | |
Frosted Microscope Slides | Corning | 12-553-10 | 75mmx25mm, with thickness of 0.9-1.1mm |
Glucose Oxidase | MP Biomedicals LLC | 195196 | Type VII, without added oxygen |
GMPCPP | Jena Biosciences | JBS-NU-405S | Can be stored for several months at -20 °C and up to a year at -80 °C |
Gold Seal-Cover Glass | Thermo Scientific | 3405 | |
HEPES | Fisher Scientific | BP310-500 | |
Imidazole | Fisher Scientific | 03196-500 | |
IPTG | Fisher Scientific | BP1755-10 | |
Laboratory dessicator | Bel-Art | 999320237 | 190mm plate size |
Kanamycin Sulfate | Fischer Scientific | BP906-5 | |
KIF5A K439 (aa:1-439)-6His | Gilbert Lab, RPI | N/A | doi.org/10.1074/jbc.RA118.002182 |
Kimwipe | Kimberley Clark | Z188956 | lint-free tissue |
Immersion Oil, Type B | Cargille | 16484 | |
Lens Tissue | ThorLabs | MC-5 | |
LuNA Laser launch (4 channel: 405, 488, 561, 640nm) | Nikon | N/A | |
Lysozyme | MP Biomedicals LLC | 100834 | |
Magnesium Acetate Tetrahydrate | Fisher Scientific | BP215-500 | |
Microfuge 18 | Beckman Coulter | 367160 | |
MPEG-SVA MW-5000 | Laysan Bio, Inc. | NC0107576 | |
Neutravadin | Invitrogen | PI31000 | |
Nikon Ti-E inverted microscope | Nikon | N/A | Nikon LuN4 Laser |
Ni-NTA Resin | Thermo Scientific | 88221 | |
Oligonucleotide – CACCTATTCTGAGTTTGCGCGA GAACTTTCAAAGGC |
IDT | N/A | |
Oligonucleotide – GCCTTTGAAAGTTCTCGCGCAA ACTCAGAATAGGTG |
IDT | N/A | |
Open-top thickwall polycarbonate tube, 0.2 mL, 7 mm x 22 mm | Beckman Coulter | 343755 | |
Optima-TLX Ultracentrifuge | Beckman Coulter | 361544 | |
Paclitaxel (Taxol equivalent) | Thermo Fisher Scientific | P3456 | |
PIPES | ACROS Organics | 172615000 | |
PMSF | Millipore | 7110-5GM | |
Porcine Tubulin, biotin label | Cytoskeleton, Inc. | T333P | |
Porcine Tubulin, HiLyte 647 Fluor | Cytoskeleton, Inc. | TL670M | far red labelled |
Porcine Tubulin, Rhodamine | Cytoskeleton, Inc. | TL590M | |
Porcine Tubulin, Tubulin Protein | Cytoskeleton, Inc. | T240 | |
Potassium Acetate | Fisher Scientific | BP364-500 | |
Prime 95B sCMOS camera | Photometric | N/A | |
Quadrant Detector Sensor Head | ThorLabs | PDQ80A | |
Quikchange Lightning Kit | Agilent Technologies | 210518 | |
Sodium Bicarbonate | Fisher Scientific | S233-500 | |
Sodium Phosphate Dibasic Anhydrous | Fisher Scientific | BP332-500 | |
Square Cover Glasses | Corning | 12-553-450 | 18 mm x 18 mm, with thickness of 0.13-0.17 mm |
Streptavidin Microspheres | Polysciences Inc. | 24162-1 | |
Superose-6 Column | GE Healthcare | 29-0915–96 | |
TCEP | Thermo Scientific | 77720 | |
TLA-100 Fixed-Angle Rotor | Beckman Coulter | 343840 | |
Ultrasonic Cleaner (Sonicator) | Vevor | JPS-08A(DD) | 304 stainless steel, 40 kHz frequency, 60 W power |
Vectabond APTES solution | Vector Laboratories | SP-1800-7 | |
Windex Powerized Glass Cleaner with Ammonia-D | S.C. Johnson | SJN695237 |