이 책의 목적은 시각화 및 초파리에서 추출한 RNA에 향상된 북부 얼룩 프로토콜의 동작 단계를 논의 배아, 세포 및 조직을 melanogaster하는 것입니다. 이 프로토콜은 작은 RNA 종의 효율적인 검출에 특히 유용하다.
지난 수십 RNA 수준에서 유전자 발현을 제어 메커니즘 주위 과학적 관심 폭발을 보아왔다. 분자 생물학의이 지점은 크게 전사 후 조절에 중요한 선수로의 RNA를 비 암호화의 발견에 의해 연료를 공급하고있다. 이러한 혁신적인 관점은 높은 처리량 레벨 (게놈 전체의 식별) 또는 단일 후보 분석 (특정 종의 정상 상태 축적)으로 모두 함께 짧은 RNA를 발현 프로파일 링에 대한 강력한 기술의 개발에 의해 촉발되었다. 여러 첨단 전략 투여 또는 도피 분자를 시각화 현재 사용할 수 있지만, 북부 오 점 분석은 RNA 발현의 즉각적이고 정확한 평가를위한 분자 생물학 자격이 접근 남아있다. 이는 많은 경우에 더 정교하고 고가의 기술의 응용을 향해 첫 단계는 쉽게 통찰력을 얻기 위해 우선적 인 방법 남아 나타내고RNA 생물학에. 여기에서 우리는 수동으로 애벌레 / 성인 조직을 해부 또는 체외 배양 된 세포에서, 전체 배아를 melanogaster 초파리에서 약하게 발현 마이크로 RNA (또는 다른 작은 규제 RNA 종)을 검출 (북 오 강화) 효율적인 프로토콜 개요. RNA의 매우 제한된 양이 필요하고 계측법 절연 세포가 될 수있는 흐름 물질의 사용은 또한 예상된다.
RNA 생화학는 지난 몇 년 동안 일에 극적으로 진행되는 발생했습니다. 유전자 발현의 조절에서 RNA 전위의 우리의 이해는 신규 한 RNA 기반 규제 메커니즘 3,4의 발견에 의해 이미 공지 된 전사 후 이벤트 깊은 특성화에 의해, 강력한 비 암호화 리보 – 레귤레이터 (2)의 식별 정보를 이용하여 버스트되었습니다 5. 모두 함께 이러한 연구가 허용 한 RNA 생물학 극적으로 현재 과학 풍경에 주요 연구 대상이되고, 현장을 확인합니다. 특히, 최근 몇 년 동안 우리는 분자 신경 생물학 (6), 현대 생명 과학에서 가장 역동적 인 연구 영역 중 하나에서 "RNA 세계"의 보급에 미치는 영향의 감각을 얻고있다. 지난 세기 지난 10 년 동안 과학 전반적인 시나리오는 RNA 간섭 7,8 발견 의해 소형 RNA를 규제 9,10의 혁명되었습니다마이크로 RNA (11)에 특정과 관련하여, 내생 적 유전자 발현의다면 발현과 조합 규제 등 거의 모든 세포 기능의 조절에 관여 작은 비 암호화 RNA를 표현.
miRNA가 높은 번호가 초파리뿐만 아니라 12 ~ 15 인간의 세포에서 발견했을 때 거의 십년 AMBROS 및 Ruvkun의 연구소에 의해 예쁜 꼬마 선충에서 miRNA의 초기 발견 후, 새롭게 관심 분야에가되었습니다. 그 이후로, 다양한 형질 전환 방법 덕분에, 초파리는 miRNA의 생합성 및 활동에 대해 깊이 탐구 귀중한 생물 컨텍스트로서 서 있었다. 초파리의 miRNA가 경로를, 신진 대사 노화 신호에서 이르기-곤충 특정 또는 진화 적으로 보존 된 프로세스에 고유 한 기능을 계시했다 행동하고, 물론, 신경. 이 방향을 따라, 우리는 최근 흥미로운 공동의 소설 링크 16을 발표했다마스터 유전자 GCM / RNA 활공 경로 사이에서 발생 rrelation. 플라이 전사 인자 GCM / 글라이드 17-19 능성에 아교 대 신경 운명의 선택이 신경 전구체 20 비행 지시 세포 운명 결정의 독특한 예를 구성한다. 스물 년이 주제에 대한 오랜 연구는 GCM /를 통해 수렴 유전자 발현 조절의 다양하고 중복 입력의 발생 신경 개발 과정에서 신경 세포와 신경 교세포의 대응 사이의 섬세한 비율을 균형에 필요한 임계 값 레벨을 설정하는 21 ~ 28 활공을 강조 분명히하고있다.
우리는 DMEL-miR279 타겟팅을 통해 그 규정은 GCM의 전사 후 미세 조정 / 16 식 활공에 기여하는 또 다른 제어 수준을 나타냅니다 발견했다. 전 세계적으로 이러한 연구 선이 필요 한 특정 방법론 개선 : 년 함께 몇 가지 기술은 원래 트라를 분석하기 위해 개발itional RNA들처럼, 작은 비 코딩의 RNA를 정량화 변환 된의 RNase 보호 분석법, cDNA를 배열 29-31, 실시간 PCR 방법 32-35 및 36,37 시퀀싱 등. 다른 측면에서, 기술적 접근 방법의 재 교정이 분야에서 지속적으로 진행되는 육성하고있다.
북부 얼룩 분석 (NB, 또는 RNA 겔 블롯 분석은) 대표 인스턴스를 구성 : 그것은 크기가 결정뿐만 아니라 모두 발현 수준의 정량을 보장 이후 크게, RNA 축적을 프로파일 사용된다. 그러나, 본 방법의 본질적인 나쁨 감도는 짧은 RNA를 원한다면, 낮은 풍부한 유전자 발현 미세 튜너에인가 될 때 제한된다. 해로운 결과는 특정 생체 시료 어려운 그 응용 프로그램을 만드는 총 RNA, 많은 양의 요구 사항입니다. 이러한 이유로, 작은 RNA를 검출을위한 특정 NB 변종의 경우 38 ~ 40를 개발되어 있습니다 : 우리는 개선 된 NB 발동을 이용했다edure 41 (ENB, 향상된 북부 오), DMEL-miR279와 GCM / 활공의 전술 상호 작용을 해명하면서.
이 방법은, 카르 보디이 미드 유도체의 활동을 기반으로 화학적 가교 결합 단계에 의존 [1 – 에틸 3 – (3 – 디메틸 아미노 프로필) 카 보디이 미드, EDC] 고체 지지체에 핵산을 고정한다. 카르 보디이 미드 활성화 카복실 또는 포스페이트 그룹 및 아민 기 (42) 사이에 아미드 결합의 형성을 촉진하는 것으로 알려진 다기능 가교제이다. 이 속성은 나일론 막의 표면에서 그룹을 아미노하기 위해 모노 인산화 된 5'-하이드 록실 그룹을 통해 공유 커플 작은 RNA들에 악용 될 수 있습니다. 얻어진 부착 구성은 다시 검출 현저한 향상 43 결과 프로브의 타겟의 혼성화의 효율을 고정화 핵산의 접근성을 높이고.
이 기술은 특정 relevanc 가정초파리 분자 연구에서 전자가있는 작은 비 암호화 RNA를 소설과 독특한 클래스의 발생이 44 떠오르고있다. 이 중, 45, 46가 순서 특정 유전자 침묵 (gene silencing)에 참여 piwi 상호 작용하는 RNA를 (piRNAs 47)의 특정 하위 유형을 구성 rasiRNAs. 이 방법의 동작 상세하게 설명 하나 rasiRNA, rasi4 중, 최초로, 마이크로 RNA-DMEL miR279 및 DMEL-miR286의 분석을 기준으로하고, 이하에서 가시화된다. 우리는 RNA (이하 1 μg)의 최소 금액에서 제대로 표현 대상도 공개 허용이 방법을, 극단으로 밀었다.
RNA가 신경을 조절 통해 얽혀 닳고 닳은 우리의 감사가 지속적으로 증가하고 있지만, 신경 줄기 세포 생물학, 신경 세포의 분화 / 기능 통합, 신경 병변 및 암의 개발에 영향을 미치는 RNA 기반 circuitries의 기계적인 의미는 미개척 남아있다. 초파리는 짧은 RNA를 비 암호화 및 전사 인자가 큰 분자 플레이어로 간주되는 비경 셀룰러 경로를 해명하는 수단으로서 melanogaster 왕국 통해 이러한…
The authors have nothing to disclose.
이 작품은 연구소 국립 드 라 상테 동부 표준시 드 라 공들인 Médicale에 의해 지원되었다, 센터 국립 드 라 공들인 과학원, 4 대학 드 스트라스부르, HOPITAL 드 스트라스부르, 협회 부어 라 공들인 쉬르 르 암, 연구소 국립 뒤 암, 직원은 국립 드 라 공들인 및 지역 알자스.
피에트로 Laneve는 라 공들인 Médicale는 Fondation에 의해 부어지지를 받고 있습니다. 현재는있는 Istituto 이탈리아 Tecnologia (IIT) 교제의받는 사람입니다. 출판 비용을 Neurex 네트워크에 의해 지원됩니다 (TriNeuron – 프로그램 Interreg IV 상단 라인)
FINAL COMPOSITION/NAME | COMPANY | CATALOGUE (Stock) | COMMENTS |
GENERAL REQUIREMENT | |||
Centrifuge, 5418 | Eppendorf | 5418 000.017 | |
Decontaminant, RNase Away | Sigma-Aldrich | 83931 | Apply on glass/plasticware, wipe and rinse |
RNase inhibitor, DEPC | Sigma-Aldrich | D5758 | Hazardous //// 1609-47-8 |
0.1 % DEPC suspension | Incubate 2 hr at 37 ˚C, then sterilize by autoclave | ||
SAMPLE PREPARATION | |||
Stereo Microscope, M60 | Leica | ||
1X PBS Buffer | |||
137 mM NaCl | Sigma-Aldrich | S3014 | 7647-14-5 |
2.7 mM KCl | Sigma-Aldrich | P9541 | 7447-40-7 |
10 mM Na2HPO4 | Sigma-Aldrich | S3264 | 7558-79-4 |
1.8 mM KH2PO4 | Sigma-Aldrich | P9791 | 7778-77-0 |
RNA EXTRACTION/ANALYSIS | |||
UV-Vis Spectrophotometer | Thermo Scientific | Nanodrop 2000 | |
Gel Imager, ChemiDoc XRS+ | Biorad | 170-8265 | |
Horizontal Electrophoresys, Mini-Sub Cell GT | BioRad | 170-4487EDU | |
RNA extraction reagent, TRIzol Reagent | Life Technologies | 15596026 | Hazardous |
PCA (25:24:1), 1:1 for extraction | Sigma-Aldrich | 77617 | 136112-00-0 |
Chlorophorm, 1:1 for extraction | Sigma-Aldrich | C2432 | 67-66-3 |
EtOH, 2.5 vol. for precipitation, 70% for washing | Sigma-Aldrich | 59844 | 64-17-5 |
Gene Ruler 1Kb DNA Ladder | Thermo Scientific | SM0311 | |
Stop Mix | |||
300 mM NaOAc, pH 5.5 | Sigma-Aldrich | S2889 | 127-09-3 |
1x RSB Solution | |||
2% sodium dodecyl sulfate (SDS) | Sigma-Aldrich | 71736 | Never cool down SDS to avoid precipitation //// 151-21-3 |
2 mg/ml Proteinase K | Roche Applied Science | 0-3115828001 | EC 3.4.21.64 9 |
10X Reticulocyte Standard Buffer (RSB) | |||
100 mM Tris-Cl, pH 7.4 | Sigma-Aldrich | T5941 | 1185-53-1 |
100 mM NaCl | Sigma-Aldrich | S3014 | 7647-14-5 |
30 mM MgCl2 | Sigma-Aldrich | M8266 | 7786-30-3 |
Denaturing Agarose Gel | |||
1.2% Agarose | Sigma-Aldrich | A9539 | Let the gel solidify for at least 1 hr //// 9012-36-2 |
1x MOPS Buffer | Add when T < 60 ˚C | ||
3% formaldehayde | Sigma-Aldrich | F8775 | Hazardous. Add when T < 60 ˚C //// 50-00-0 |
10X MOPS Buffer | |||
0.2 M MOPS sodium salt, pH 7 | Sigma-Aldrich | M9381 | Do not confuse MOPS sodium salt with MOPS //// 71119-22-7 |
Agarose Loading Dye | |||
1x MOPS Buffer | |||
3% formaldehyde | Sigma-Aldrich | F8775 | Hazardous //// 50-00-0 |
50% formamide | Sigma-Aldrich | 47670 | Hazardous //// 75-12-7 |
Ethidium bromide (EtBr) 30 μg/ml | Sigma-Aldrich | E1510 | Hazardous //// 1239-45-8 |
Bromophenol blue | Sigma-Aldrich | B0126 | 115-39-9 |
SMALL RNA FRACTIONATION | |||
Flat gel loading tips | Life Technologies | LC1002 | |
Savant SpeedVac Concentrator | Thermo Scientific | DNA120 | |
Vertical Electrophoresis, Mini-PROTEAN Tetra Cell | Biorad | 165-8000 | |
Denaturing Acrilamide Gel | |||
10% acrylamide/bis-acrylamide (19:1) | Sigma-Aldrich | A3449 | Hazardous. Let the gel polymerizefor 45 min before use |
1x TBE Buffer (or 1x MOPS Buffer) | |||
7 M urea | Sigma-Aldrich | U6504 | 57-13-6 |
0.1% ammonium persulfate | Sigma-Aldrich | 215589 | 7727-54-0 |
0.1% TEMED | Sigma-Aldrich | T9281 | 110-18-9 |
Gene Ruler Ultra Low Range DNA Ladder (10 bp-step) | Thermo Scientific | SM1211 | Label 0.1 μg, as described in the "probe labeling" reaction |
Acrylamide Blue Dye | |||
50% formamide | Sigma-Aldrich | 47670 | Hazardous //// 75-12-7 |
Bromophenol blue | Sigma-Aldrich | B0126 | 115-39-9 |
Running Buffer (RB) | |||
1x MOPS Buffer | |||
Alternative RB: 1x TBE Buffer | |||
1x TBE Buffer | |||
5X TBE | |||
445 mM Tris-base | Sigma-Aldrich | T1503 | 77-86-1 |
445 mM boric acid | Sigma-Aldrich | B7901 | 10043-35-3 |
20 mM EDTA | Sigma-Aldrich | EDS | 60-00-4 |
Gel Staining Solution | |||
Ethidium bromide 0.5 μg/ml | Sigma-Aldrich | E1510 | Hazardous //// 1239-45-8 |
1x RB | Stain for 15 min with EtBr, destain for 15 min w/o EtBr | ||
BLOTTING | |||
3MM Whatman paper | Sigma-Aldrich | Z270849 | |
Neutral Nylon Membrane, Hybond NX | GE Healthcare Life Science | RPN203T | Photosensitive |
CROSSLINKING | |||
Crosslinking Solution (XLS) | |||
1% 1-methylimidazole (v/v) | Sigma-Aldrich | 336092 | Always prepare a fresh aliquot of XLS //// 616-47-7 |
12.5 mM HCl | Sigma-Aldrich | H1758 | Hazardous //// 7647-01-0 |
3.1% EDC (w/v) | Sigma-Aldrich | 3450 | 25952-53-8 |
(PRE)-HYBRIDIZATION | |||
Liquid Scintillation Counter | Beckmann | LS 6500 | |
Sheared Salmon Sperm, 0.1 mg/ml | Life Technologies | AM9680 | |
rasi4 antisense probe | 5' CGGUGUUCGACAGUUCCUCGGG -3' | ||
5s-rRNA antisense probe | 5'-CAACACGCGGTGTTCCCAAGCCG-3' | ||
Dmel-miR279 antisense probe | 5'-TTAATGAGTGTGGATCTAGTCA-3' | ||
Dmel-miR286 antisense probe | 5'-AGCACGAGTGTTCGGTCTAGTCA-3' | ||
Purification Kit, Illustra MicroSpin G-25 Columns | GE Healthcare Life Science | 27-5325-01 | |
(Pre)-Hybridization Solution (HS) | |||
6x SSPE | Pre-warm HS at 37 ˚C before use | ||
0.5% SDS | Sigma-Aldrich | 71736 | 151-21-3 |
5x Denhardt's Solution | |||
20X SSPE | |||
3.6 M NaCl | Sigma-Aldrich | S3014 | 7647-14-5 |
0.2 M sodium phosphate | Sigma-Aldrich | 342483 | 7601-54-9 |
20 mM EDTA (pH 8.0) | Sigma-Aldrich | EDS | 60-00-4 |
50x Denhardt's Solution | |||
1% Ficoll 400 (w/v) | Sigma-Aldrich | F2637 | 26873-85-8 |
1% Polyvinylpyrrolidone | Sigma-Aldrich | PVP40 | 9003-39-8 |
1% BSA | Sigma-Aldrich | A7906 | 9048-46-8 |
1X TEN Buffer | |||
10 mM Tris-Cl (pH 8.0) | Sigma-Aldrich | T1503 | 77-86-1 |
100 mM NaCl | Sigma-Aldrich | S3014 | 7647-14-5 |
1 mM EDTA (pH 8.0) | Sigma-Aldrich | EDS | 60-00-4 |
Probe Labelling | |||
0.4 μM oligonucleotide | |||
1.5 μl Ci/μl [γ-32P] ATP | Perkin Elmer | NEG002A | Hazardous //// 51963-61-2 |
1x T4 Polynucleotide Kinase Buffer | Biolabs | B0201 | |
T4 Polynucleotide Kinase 0.5 units/μl | Biolabs | M0201 | EC 2.7.1.78 |
30 min at 37 ˚C, stop by 20 mM EDTA | |||
WASHING | |||
Geiger Mueller Detectors | Canberra Industries | MCB2/CPS – EM77021 | |
Washing Buffer (WB), 2x SSPE | |||
Stringent Washing Buffers | |||
0.2x SSPE | |||
2x SSPE, 0.5% SDS | |||
0.2x SSPE, 0.5% SDS | |||
SIGNAL DETECTION | |||
PharosFX Plus System | Biorad | 170-9460 | |
Image J | Freely available | ||
Quantity One | Biorad | ||
X-ray films , BioMax XAR | Sigma-Aldrich | F5888 | Photosensitive |
Developer for X-ray films | Sigma-Aldrich | P7042 | |
Fixer for X-ray films | Sigma-Aldrich | P7167 | |
STRIPPING | |||
Stripping Solution | |||
10 mM Tris-HCl pH 8.8 | Sigma-Aldrich | T1503 | 77-86-1 |
5 mM EDTA | Sigma-Aldrich | EDS | 60-00-4 |
0.1% SDS | Sigma-Aldrich | 71736 | Add SDS after boiling to avoid foaming //// 151-21-3 |