Summary

의 정화 M. magneticum 스트레인 AMB - 1 Magnetosome 관련 단백질 MamAΔ41

Published: March 25, 2010
doi:

Summary

엄마가 magnetosome 활성화에 참여하는 표시되었습니다 독특한 Magnetosome 관련된 단백질이다. 여기에서 엄마가 삭제 돌연변이의 정화 프로토콜 (MamAΔ41)을 제시<em> M. magneticum</em> AMB – 1.

Abstract

Magnetotactic 박테리아는 지자기의 필드 함께 스스로를 동쪽을 향하게 수 있습니다 수생 미생물의 다양한 그룹을 구성. 이 문제는 적합한 환경에서 검색을 돕기 위해 생각됩니다<em> (1)</em>. 이 기능은 magnetosome에 의해 수여됩니다 지질의 선형 체인 어셈블리로 구성되어 subcellular organelle은 자철광 또는 greigite의 ~ 50 나노미터 크리스탈 biomineralize하고 묶으에 각 수 vesicles. 기능 vesicles의 형성에 필요한 것으로 표시되었다 magnetosome의 주요 구성 요소가 마마입니다. 엄마가 가장 특징 magnetosome – 관련 단백질 중 하나입니다 매우 풍부한 magnetosome – 관련 단백질입니다<em> 생체내에</em><em> (2-6)</em>. 이 문서는, 엄마의 정화에 초점을 맞추고있는 연구 임에도 불구하고<em> 생체내에</em> 더 명확한 기능이나 구조 자세한 사항은 그것을 발견되지 않았습니다. 생물 정보학 분석 엄마가 단백질을 포함하는 테트라 – tricopeptide 반복 (TPR)입니다 것을 제안했습니다. TPR은 단백질의 다양한 큰 접어 이러한이나 성형 일환으로 발견 구조적 모티프이며, 그것은 단백질 – 단백질 상호 작용과 mediates 다중 단백질 단지에 대한 템플릿 역할<em> (7)</em>. TPRs는 진핵 세포 organelle 프로세스와 많은 세균 경로에 많은 중요한 작업에 참여<em> (8-14).</em엄마 이해하기> 위해서는 단백질을 포함하는 독특한 TPR은 매우 정제된 단백질은 첫 단계로 필요합니다. 이 문서에서는, 우리는에서 안정적인 엄마를 삭제 돌연변이 (MamAΔ41)에 대한 정화 프로토콜을 제시<em> M. magneticum</em> AMB – 1.

Protocol

1. E.에 엄마가 진의 복제와 표현 대장균 5' – GCATTACGCATATGGACGACATCCGCCAGGTG – 3 '와 5' – GCGCGGCAGCCATA – TGGCATACG – 3'돌연변이 유전자 mamAΔ41는 primers와 Magnetospirillum magneticum AMB – 1의 게놈 DNA의 중합 효소의 연쇄 반응 (PCR)을 사용하여 증폭되었습니다. 증폭된 DNA 조각에서 NcoI 사이트는 개시 코돈 ATG에서 도입하고 종료 코돈은 ScoI 사이트로 교체되었습니다. 조?…

Discussion

단백질 정제는 생화학 단백질이나 구조 연구의 주요 단계입니다. 각각의 단백질 자체 동작과 독특한 있기 때문에 하나의 속성을 정의하고 이에 따라 그 정화를 수정해야합니다. 단백질 대상은 생물 정보학 도구를 사용하여 정화위한 첫 단계로 분석을해야합니다. 그들은 대상 ISO – 전기 지점을 계산 환경 및 특수 이온 / 리간드에 대한 필요성을 감소 / 산화에 대한 필요성을 평가하는 데 사용됩니?…

Acknowledgements

우리는 그들의 조언과 의견을 자신의 지원과 Geula 다비도프, 노암 Grimberg와 첸 박사 Guttman에 대한 아미르 Aharoni을 인정합니다.

Materials

Material Name Type Company Catalogue Number Comment
French Press Equipment Thermo scientific FA-078A  
Pressure cell Equipment Thermo scientific FA-032  
Ultra-centrifuge Equipment Sorvall Discovery 90SE  
Rottor Equipment Beckman Ti60  
Ultra-centrifuge tubes; PC-Bottle+Cap Assay 26.3ml Equipment Beckman BC-355618  
2.5cm diameter, Glass Econo-Column Chromatography Columns Equipment BioRad 737-2521  
Ni-NTA His Bind resin Equipment Novagen M0063428  
Spectrophotometer Equipment Amersham Biosiences Ultraspec 2100 pro  
Quartz cuvette Equipment Hellma 104-QS  
Fast Performance Liquid Chromatography- AKTA purifier 10 Equipment GE Healthcare Biosciences 28-4062-64  
Ion exchange column – MonoQ 4.6/100 PE Equipment GE Healthcare Biosciences 10025543  
Size exclusion pre-packed column-HiLoad 26/60 Superdex 200 Equipment GE Healthcare Biosciences 17-1071-01  
Centricon – Vivaspin15 – 10,000 MWCO Equipment Sartorius Stedim Biotech GmbH VS1501  
Table centrifuge Equipment Thermo scientific IEC CL30R  
MALDI-TOF Equipment Bruker Daltonics Reflex IV  
Tris-HCl (hydrotymethyl) aminomethane Reagent BioLab 20092391  
Sodium Chloride Reagent FRUTROM 235553470  
Imidazole Reagent Alfa Aesar 288-32-4  
EDTA free protease inhibitors cocktail Reagent Sigma P-8849  
Dnase I (Deoxyribonuclease I) Reagent Sigma DN-25  
Bovine Thrombin Reagent Fisher BioReagents BP25432  
Glycine Reagent BioLab 07132391  
Soudim Dodecyl Sulfate (SDS) Reagent BioLab 19822391  
Beta-mercaptoethanol Reagent Sigma M-3148  
InstantBlue Reagent Expedeon 1SB01L  
PageRuler Prestained Protein Ladder Reagent Fermentas SM0671  

References

  1. Faivre, D., Schuler, D. Magnetotactic Bacteria and Magnetosomes. Chem Rev. 108, 4875-4898 (2008).
  2. D’Andrea, L. D., Regan, L. TPR proteins: the versatile helix. Trends Biochem Sci. 28, 655-662 (2003).
  3. Young, J. C., Barral, J. M., Hartl, U. l. r. i. c. h., F, . More than folding: localized functions of cytosolic chaperones. Trends Biochem Sci. 28, 541-547 (2003).
  4. Brocard, C., Hartig, A. Peroxisome targeting signal 1: is it really a simple tripeptide?. Biochim Biophys Acta. 1763, 1565-1573 (2006).
  5. Fransen, M., Amery, L., Hartig, A., Brees, C., Rabijns, A., Mannaerts, G. P., Van Veldhoven, P. P. Comparison of the PTS1- and Rab8b-binding properties of Pex5p and Pex5Rp/TRIP8b. Biochim Biophys Acta. 1783, 864-873 (2008).
  6. Baker, M. J., Frazier, A. E., Gulbis, J. M., Ryan, M. T. Mitochondrial protein-import machinery: correlating structure with function. Trends Cell Biol. 17, 456-464 (2007).
  7. Mirus, O., Bionda, T., von Haeseler, A., Schleiff, E. Evolutionarily evolved discriminators in the 3-TPR domain of the Toc64 family involved in protein translocation at the outer membrane of chloroplasts and mitochondria. J Mol Model. 15, 971-982 (2009).
  8. Gatsos, X., Perry, A. J., Anwari, K., Dolezal, P., Wolynec, P. P., Likic, V. A., Purcell, A. W., Buchanan, S. K., Lithgow, T. Protein secretion and outer membrane assembly in Alphaproteobacteria. FEMS Microbiol Rev. 32, 995-1009 (2008).
  9. Tiwari, D., Singh, R. K., Goswami, K., Verma, S. K., Prakash, B., Nandicoori, V. K. Key residues in Mycobacterium tuberculosis protein kinase G play a role in regulating kinase activity and survival in the host. J Biol Chem. 284, 27467-27479 (2009).
  10. Edqvist, P. J., Broms, J. E., Betts, H. J., Forsberg, A., Pallen, M. J., Francis, M. S. Tetratricopeptide repeats in the type III secretion chaperone, LcrH: their role in substrate binding and secretion. Mol Microbiol. 59, 31-44 (2006).
  11. Grunberg, K., Muller, E. C., Otto, A., Reszka, R., Linder, D., Kube, M., Reinhardt, R., Schuler, D. Biochemical and proteomic analysis of the magnetosome membrane in Magnetospirillum gryphiswaldense. Appl Environ Microbiol. 70, 1040-1050 (2004).
  12. Komeili, A., Vali, H., Beveridge, T. J., Newman, D. K. Magnetosome vesicles are present before magnetite formation, and MamA is required for their activation. Proc Natl Acad Sci USA. 101, 3839-3843 (2004).
  13. Okuda, Y., Fukumori, Y. Expression and characterization of a magnetosome-associated protein, TPR-containing MAM22, in Escherichia coli. FEBS Lett. 491, 169-173 (2001).
  14. Taoka, A., Asada, R., Sasaki, H., Anzawa, K., Wu, L. F., Fukumori, Y. Spatial localizations of Mam22 and Mam12 in the magnetosomes of Magnetospirillum magnetotacticum. J Bacteriol. 188, 3805-3812 (2006).
  15. Studier, F. W. Protein production by auto-induction in high density shaking cultures. Protein Expression and Purification. 41, 207-234 (2005).

Play Video

Cite This Article
Zeytuni, N., Zarivach, R. Purification of the M. magneticum Strain AMB-1 Magnetosome Associated Protein MamAΔ41. J. Vis. Exp. (37), e1844, doi:10.3791/1844 (2010).

View Video