This protocol aims to isolate cell-type-specific translating ribosomal mRNAs using the NuTRAP mouse model.
Cellular heterogeneity poses challenges to understanding the function of complex tissues at a transcriptome level. Using cell-type-specific RNAs avoids potential pitfalls caused by the heterogeneity of tissues and unleashes the powerful transcriptome analysis. The protocol described here demonstrates how to use the Translating Ribosome Affinity Purification (TRAP) method to isolate ribosome-bound RNAs from a small amount of EGFP-expressing cells in a complex tissue without cell sorting. This protocol is suitable for isolating cell-type-specific RNAs using the recently available NuTRAP mouse model and could also be used to isolate RNAs from any EGFP-expressing cells.
High-throughput approaches, including RNA sequencing (RNA-seq) and microarray, have made it possible to interrogate gene expression profiles at the genome-wide level. For complex tissues such as the heart, brain, and testis, the cell-type-specific data will provide more details comparing the use of RNAs from the whole tissue1,2,3. To overcome the impact of cellular heterogeneity, the Translating Ribosome Affinity Purification (TRAP) method has been developed since early 2010s4. TRAP is able to isolate ribosome-bound RNAs from specific cell types without tissue dissociation. This method has been used for translatome (mRNAs that are being recruited to the ribosome for translation) analysis in different organisms, including targeting an extremely rare population of muscle cells in Drosophila embryos5, studying different root cells in the model plant Arabidopsis thaliana6, and performing transcriptome analysis of endothelial cells in mammals7.
TRAP requires a genetic modification to tag the ribosome of a model organism. Evan Rosen and colleagues recently developed a mouse model called Nuclear tagging and Translating Ribosome Affinity Purification (NuTRAP) mouse8, which has been available through the Jackson Laboratory since 2017. By crossing with a Cre mouse line, researchers can use this NuTRAP mouse model to isolate ribosome-bound RNAs and cell nuclei from Cre-expressing cells without cell sorting. In Cre-expressing cells that also carry the NuTRAP allele, the EGFP/L10a tagged ribosome allows the isolation of translating mRNAs using affinity pulldown assays. At the same cell, the biotin ligase recognition peptide (BLRP)-tagged nuclear membrane, which is also mCherry positive, allows the nuclear isolation by using affinity- or fluorescence-based purification. The same research team also generated a similar mouse line in which the nuclear membrane is labeled only with mCherry without biotin8. These two genetically modified mouse lines give access to characterize paired epigenomic and transcriptomic profiles of specific types of cells in interest.
The hedgehog (Hh) signaling pathway plays a critical role in tissue development9. GLI1, a member of the GLI family, acts as a transcriptional activator and mediates the Hh signaling. Gli1+ cells can be found in many hormone-secreting organs, including the adrenal gland and the testis. To isolate cell-type-specific DNAs and RNAs from Gli1+ cells using the NuTRAP mouse model, Gli1-CreERT2 mice were crossed with the NuTRAP mice. Shh-CreERT2 mice were also crossed with the NuTRAP mice aim to isolate sonic hedgehog (Shh) expressing cells. The following protocol shows how to use Gli1-CreERT2;NuTRAP mice to isolate ribosome-bound RNAs from Gli1+ cells in adult mouse testes.
All performed animal experiments followed the protocols approved by the Institutional Animal Care and Use Committees (IACUC) at Auburn University.
NOTE: The following protocol uses one testis (about 100 mg) at P28 from Gli1-CreERT2; NuTRAP mice (Mus musculus). Volumes of reagents may need to be adjusted based on the types of samples and the number of tissues.
1. Tissue collection
2. Reagents and beads preparation
3. Tissue lysis and homogenization
4. Immunoprecipitation
5. RNA extraction
NOTE: The following steps are adapted from the RNA isolation kit (Table of Materials). Treat each fraction (i.e., input, positive, and negative) as an independent sample and isolate RNAs independently.
6. RNA concentration and quality
7. Storage and further analysis
Gli1-CreERT2 mouse (Jackson Lab Stock Number: 007913) were first crossed with the NuTRAP reporter mouse (Jackson Lab Stock Number: 029899) to generate double-mutant mice. Mice carrying both genetically engineered gene alleles (i.e., Gli1-CreERT2 and NuTRAP) were injected with tamoxifen once a day, every other day, for three injections. Tissue samples were collected on the 7th day after the 1st day of the injection. Immunofluorescence analysis showed that the EGFP was expressed in interstitial cells in testes (Figure 1). The adrenal gland capsule has been known to be another cell population positive of Gli112,13. EGFP was also found in adrenal capsular cells in Gli1-CreERT2;NuTRAP mice (Figure 1). Our lab also carries Shh-CreERT2;NuTRAP mice. Note that in Shh-CreERT2;NuTRAP mice, the EGFP+ cell population resides in the outer cortex of the adrenal gland underneath the capsule (Figure 1), the same expression site of EGFP+ cells in Shh+ area in the adrenal gland13 confirming the expression of EGFP in Cre-expressing cells.
After the extraction of the cell-type-specific RNAs, the quantity and quality of isolated RNAs in each fraction from two independent extractions (one testis used in each extraction) were assessed using a bioanalyzer (Figure 2). The bioanalyzer result indicated that this protocol is able to obtain high-quality RNAs from all three fractions. All fractions had a similar RNA Integrity Number (RIN).
To further test whether the extracted RNA is cell-type-specific, extracted RNA was sent for microarray analysis using a commercial microarray service (see Table of Materials). The microarray result showed that about 4,000 genes were enriched in the positive fraction comparing to the negative fraction, whereas about 3,000 genes were enriched in the negative fraction (Figure 3). Among these differentially expressed genes, Leydig-cell-associated genes Hsd11b1 and Hsd3b614,15 were enriched in the positive fraction. In the negative fraction, the Sertoli-cell-associated genes Dhh and Gstm616,17 were enriched. Only a few differentially expressed genes were identified when comparing the negative fraction with the input.
Real-time quantitative RT-PCR (qPCR) was also used to confirm the expression of key genes in the positive fraction and the negative fraction. Similar to what was found in the microarray assay, steroidogenic enzymes 3β-Hydroxysteroid dehydrogenase (encoded by Hsd3b) and cholesterol side-chain cleavage enzyme (encoded by Cyp11a1) were enriched in the positive fraction. Whereas the Sertoli cell marker Sox9 (SRY-box Transcription Factor 9), and the germ cell marker Sycp3 (Synaptonemal Complex Protein 3), were enriched in the negative fraction (Figure 4). Together these data demonstrated that the transcriptomes in Gli1+ cells were successfully pulled down and enriched by the above protocol.
Figure 1: Immunofluorescence images of the EGFP expression in NuTRAP reporter mouse models. The Gli1-CreERT2;NuTRAP and the Shh-CreERT2;NuTRAP mice were treated with tamoxifen to activate the EGFP expression. In the testis, Gli1+ cells were in the interstitium, whereas in the adrenal gland, Gli1+ cells were in the adrenal capsule. In the adrenal gland, cells underneath the capsule were positive of SHH (EGFP+ cells in Shh-CreERT2;NuTRAP mice). SHH is the ligand of the SHH signaling pathway which elicits its function in Gli1+ capsular cells13. Scale bars: 50 µm. Please click here to view a larger version of this figure.
Figure 2: RNA quality and quantity from the TRAP extraction. RNAs of the positive fraction, the negative fraction, and the input were evaluated using a bioanalyzer. The positive fraction contains RNAs extracted from protein G beads after the incubation with the GFP antibody (step 4.1). The negative fraction contains RNAs that remain in the supernatant at step 4.2. The input contains RNAs from the homogenate (step 3.3). In the electropherogram, because the concentrations of the lower marker (displayed as the first peak at 20-25 s of the migration time of samples shown on the X-axis) and the ladder (not shown in these electropherograms) are known, the concentration of each sample can be calculated. The two major peaks at 40-50 s represent the 18S and 28S rRNA. The ribosomal ratio (based on the fluorescence intensity shown on the Y-axis) is used to determine the integrity of the RNA sample. The RNA Integrity Number (RIN) of each sample is shown on the top right corner of each plot. Each dot in the dot plot represents the amount of RNA that was extracted from one single testis. The amount of RNA of each sample in the negative fraction and the input was extracted from 25 µL of samples. Please click here to view a larger version of this figure.
Figure 3: Microarray analysis for TRAP samples. Results of two extractions (one testis each) are shown. The microarray analysis identified a similar number of differentially expressed genes from two independent extractions (Testis A and Testis B). Around 4,000 genes were enriched (red dots) in the positive fraction, whereas ~3,000 genes were enriched (green dots) in the negative fraction. Hsd11b1 and Hsd3b6 were enriched in positive fractions. Dhh and Gstm6 were enriched in negative fractions. Only a few genes were identified as differentially expressed genes between the negative fraction and the input, suggesting the testis only contains a very small number of Gli1+ cells. Please click here to view a larger version of this figure.
Figure 4: qPCR analysis for TRAP samples. qPCR analysis showed the relative expression of cell-type-specific genes in the positive fraction and the negative fraction. The expression of each gene was first normalized with Actb. The relative expressions of genes within the positive fraction were then calculated based on the expression of Sox9 (set as 10). For the negative fraction, Cyp11a1 (set as 10) was used to normalize the relative expression. Note that the relative expression of target genes can only be compared within each fraction. Genes that encode the steroidogenic enzymes (Hsd3b and Cyp11a1) were enriched in the positive fraction. Whereas the marker gene for germ cells (Scyp3) and Sertoli cells (Sox9), were enriched in the negative fraction. Three biological replicates (three independent extractions, one testis each) were shown. Please click here to view a larger version of this figure.
The usefulness of the whole-tissue transcriptome analysis could be dampened, especially when studying complex heterogeneous tissues. How to obtain cell-type-specific RNAs becomes an urgent need to unleash the powerful RNA-seq technique. The isolation of cell-type-specific RNAs usually relies on the collection of a specific type of cells using micromanipulation, fluorescent-activated cell sorting (FACS), or laser capture microdissection (LCM)18. Other modern high-throughput single-cell collection methods and instruments have also been developed19. These methods usually employ the microfluidics techniques to barcode single cells followed by single-cell RNA-seq. Cell dissociation is the required step to obtain the suspended cell solution, which then will go through either a cell sorter or a microfluidic device to barcode each cell. The cell dissociation step introduces challenges to these methods for cell-type-specific studies because the enzymatic treatment not only breaks down tissues but also affects cell viability and transcriptional profiles20. Moreover, the expense for single-cell RNA-seq is usually high and requires specialized equipment on site.
Recently, two studies successfully isolated RNA/DNA of specific cell types from whole tissues using the NuTRAP mice8,21. Without using specific equipment and tools, the NuTRAP mouse model allows obtaining RNAs and DNAs from specific types of cells. The NuTRAP allele could target Cre-expressing cells without the cell dissociation step, avoiding changing cell's viability and transcriptional profiles. Rol et al. used the NuTRAP mouse model to isolate nuclei and translate mRNA simultaneously from adipose tissue. The other study also demonstrated that the NuTRAP mouse model could work for glial cells in the central nervous system8.
In our lab, we are interested in studying the stem cell populations in steroidogenic tissues such as Gli1+ interstitial cells in the testis22 and Gli1+ capsular cells in the adrenal gland13. The challenge of studying Gli1+ cells in these two organs is that the number of Gli1+ cells in the testis and the adrenal gland is small. For example, the proportion of Leydig cells, which are the major population of Gli1+ cells in the testis, only occupy about 3.8% of the total testis volume in adult mice23. Because the TRAP technique aims to specifically pull down translating ribosome-bound RNAs in complex tissue, the NuTRAP mouse model could be a powerful tool suitable for studying a rare cell population in a complex tissue. The previously published protocols using NuTRAP mice target adipocytes and glial cells that are more abundant in the brain and adipose tissue compared to Gli1+ cells in the testis and in the adrenal gland. To ensure obtaining required RNAs from a small number of cells in a complex tissue, we revised the existing protocols by (1) increasing the incubation time with the GFP antibody from 1 h to overnight; (2) using another type of RNA extraction kit which aims to isolate a small amount of RNA at a picogram level.
We demonstrated that this protocol could obtain high-quality cell-type-specific RNAs from a small number of cells in a complex tissue. The quality and quantity of extracted RNAs are capable for qPCR and a commercial microarray service. Results from microarray and qPCR confirmed that Leydig-cells-associated genes are enriched in the positive fraction coming from one testis. The protocol here provides a detailed approach to isolate cell-type-specific translating ribosome mRNAs using the NuTRAP mouse model. This protocol may also be used to isolate RNAs from any EGFP-expressing cells.
The authors have nothing to disclose.
This work was partially supported by NIH R00HD082686. We thank the Endocrine Society Summer Research Fellowship to H.S.Z. We also thank Dr. Yuan Kang for breeding and maintaining the mouse colony.
Actb | eurofins | qPCR primers | ATGGAGGGGAATACAGCCC / TTCTTTGCAGCTCCTTCGTT (forward primer/reverse primer) |
Bioanalyzer | Agilent | 2100 Bioanalyzer Instrument | |
cOmplete Mini EDTA-free Protease Inhibitor Cocktail | Millipore | 11836170001 | |
cycloheximide | Millipore | 239764-100MG | |
Cyp11a1 | eurofins | qPCR primers | CTGCCTCCAGACTTCTTTCG / TTCTTGAAGGGCAGCTTGTT (forward primer/reverse primer) |
dNTP | Thermo Fisher Scientific | R0191 | |
DTT, Dithiothreitol | Thermo Fisher Scientific | P2325 | |
DynaMag-2 magnet | Thermo Fisher Scientific | 12321D | |
Falcon tubes 15 mL | VWR | 89039-666 | |
GFP antibody | Abcam | ab290 | |
Glass grinder set | DWK Life Sciences | 357542 | |
heparin | BEANTOWN CHEMICAL | 139975-250MG | |
Hsd3b | eurofins | qPCR primers | GACAGGAGCAGGAGGGTTTGTG / CACTGGGCATCCAGAATGTCTC (forward primer/reverse primer) |
KCl | Biosciences | R005 | |
MgCl2 | Biosciences | R004 | |
Microcentrifuge tubes 2 mL | Thermo Fisher Scientific | 02-707-354 | |
Mouse Clariom S Assay microarrays | Thermo Fisher Scientific | Microarray service | |
NP-40 | Millipore | 492018-50 Ml | |
oligo (dT)20 | Invitrogen | 18418020 | |
PicoPure RNA Isolation Kit | Thermo Fisher Scientific | KIT0204 | |
Protein G Dynabead | Thermo Fisher Scientific | 10003D | |
RNase-free water | growcells | NUPW-0500 | |
RNaseOUT Recombinant Ribonuclease Inhibitor | Thermo Fisher Scientific | 10777019 | |
Sox9 | eurofins | qPCR primers | TGAAGAACGGACAAGCGGAG / CTGAGATTGCCCAGAGTGCT (forward primer/reverse primer |
Superscript IV reverse transcriptase | Invitrogen | 18090050 | |
SYBR Green PCR Master Mix | Thermo Fisher Scientific | 4309155 | |
Sycp3 | eurofins | qPCR primers | GAATGTGTTGCAGCAGTGGGA /GAACTGCTCGTGTATCTGTTTGA (forward primer/reverse primer) |
Tris | Alfa Aesar | J62848 |