HIV-1 pathogenesis is defined by both viral characteristics and host genetic factors. Here we describe a robust method that allows for reproducible measurements to assess the impact of the gag gene sequence variation on the in vitro replication capacity of the virus.
The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target conserved portions of the HIV-1 genome that escape with difficulty. Sequence changes attributed to cellular immune pressure arise across the genome during infection, and if found within conserved regions of the genome such as Gag, can affect the ability of the virus to replicate in vitro. Transmission of HLA-linked polymorphisms in Gag to HLA-mismatched recipients has been associated with reduced set point viral loads. We hypothesized this may be due to a reduced replication capacity of the virus. Here we present a novel method for assessing the in vitro replication of HIV-1 as influenced by the gag gene isolated from acute time points from subtype C infected Zambians. This method uses restriction enzyme based cloning to insert the gag gene into a common subtype C HIV-1 proviral backbone, MJ4. This makes it more appropriate to the study of subtype C sequences than previous recombination based methods that have assessed the in vitro replication of chronically derived gag-pro sequences. Nevertheless, the protocol could be readily modified for studies of viruses from other subtypes. Moreover, this protocol details a robust and reproducible method for assessing the replication capacity of the Gag-MJ4 chimeric viruses on a CEM-based T cell line. This method was utilized for the study of Gag-MJ4 chimeric viruses derived from 149 subtype C acutely infected Zambians, and has allowed for the identification of residues in Gag that affect replication. More importantly, the implementation of this technique has facilitated a deeper understanding of how viral replication defines parameters of early HIV-1 pathogenesis such as set point viral load and longitudinal CD4+ T cell decline.
Ana ve HIV-1 patogenezi ve hastalığın ilerlemesi rasyonel aşı tasarımı için her şeyden önemlidir etkileyen viral özelliklerini hem belirlenmesi. Hücresel bağışıklık tepkisi, HIV-1 enfeksiyonu, insan bağışıklık tepkisinin temel bir bileşenidir. Sitotoksik T lenfositleri (CTL), akut viremi başlangıç kontrolü için gerekli olan ve ana sabit bir düzeye (set noktası) virüs yükü, 1,2 kurmaya olanak verir. Bu efektör hücrelerin deneysel tükenmesi viral kontrole 3,4 kaybı ile sonuçlanır. Buna rağmen, mutasyon viral yönden enfekte hücreler 5-9 arasında CTL tanıması bozmak, viral genom içinde ortaya için dizayn edildi.
Belirli HLA allelleri düşük viral yük ve B * 57, B * 27 ve B * 81 10-15 olmak üzere yavaş hastalığın ilerlemesi ile ilişkilendirilmiştir. HLA sınıf I alelleri koruyucu yarar bir kısmı, örneğin Gag gibi genomunun işlevsel olarak sınırlı bölgeleri hedef gerçeğine atfedilebilirve in vitro 16-21 çoğaltmak virüsün yeteneğini azaltmak kaçış mutasyonları için seçin. Hücresel bağışıklık sistemi için bir kaçış I aleli seçme HLA sınıf bağlamında virüse yararlı olmakla birlikte, bu mutasyonlar etkisinin bir HLA-uyumsuz 22,23 münferit iletim üzerine ev için farklı sonuçlara yol açabilir. Bu nedenle, viral replikasyon kapasitesi üzerinde iletilen HLA ilişkili kaçış mutasyonların etkilerini anlamak erken HIV-1 patogenezinde anlayışımızı ilerletmek için önemli olacaktır.
Ben 24-29 kadar ilerleme allel spesifik HLA sınıf ile ilişkili bireysel kaçış mutasyonları fitness kusurları tespit ve karakterize etmek için yapılmış olmakla birlikte, doğal olarak, HIV-1 izolatları, HLA ilişkili polimorfizmlerin özel ve karmaşık bir ayak izleri büyük olasılıkla HLA kaynaklanan olarak oluşan Farklı immünogenetik geçmişlere 30 aracılıkh bağışıklık basıncı. Apnceki analizi, Goepfert ve diğ. 88 akut enfekte Zambiyalılar türetilen iletilen Gag dizilerinde HLA ilişkili bir mutasyon birikimi ayar noktası viral yükte 31 bir azalma ile ilişkili olduğunu göstermiştir. Bu HLA uyumsuz alıcılara özel Gag zararlı kaçış mutasyonları iletim, bir klinik yarar sağlar ve viral replikasyon zayıflatılmış bağlı olabileceğini düşündürmektedir. İleride, bu tür çoğaltma kapasitesi ve erken çoğaltma sırayla HIV-1 klinik parametreleri ve geç-sahne nasıl etkileyebileceğini olarak iletilen virüsün özelliklerini tanımlamak için konser çalışmaları nasıl karmaşık Gag polimorfizmlerinin kombinasyonları doğal olarak oluşan izolatları içinde çalışmaya zorunlu olduğunu patogenezi.
Broekman et al. Birinci alt tip C ve hem de B enfeksiyonlarının kronik aşamalı enfeksiyon ve viral yükü sırasında izole gag-pro sekansları replikasyon kapasitesi arasında bir bağ göstermiştir32-35. Bu çalışmalarda sunulan deneysel yaklaşım, kronik olarak enfekte edilmiş bireylerden türetilen dizilerinin in vitro replikasyon kapasitesi incelenmesi için her ne kadar uygun olan, akut enfeksiyonlu bireyler zor alt tip C, HIV-1 replikatif kapasite ders yapmayı çok sayıda teknik belgesine ve sınırlamalar vardır. Bu yöntem LAV kısmen elde edildi alt tip B NL4-3 Provirüsün, içine nüfus tabanlı PCR çoğaltılmış dizi rekombinasyon dayanan, bir laboratuvar virüs stokları 36 uyarlanmıştır. Virüs üretimi PCR amplikonlarının bir CEM dayalı T hücre hattı 37 birlikte-transfeksiyonu ile gerçekleştirilebilir ve delta-gag-Pro NL4-3 DNA sindirildi. Bu yöntem, potansiyel olarak, in vivo olarak, viral quasi ile ilgili olarak geri kazanılan virüs stokunun doğasını eğriltme ve bu nedenle in vitro replikasyon kapasitesi ölçülmesini değiştirerek, haftalar ve aylar arasında bir süre içinde virüsünün gelişimini gerektirir. Bu yöntem, Ikronik olarak enfekte bireylerin büyük bir sayıda çok sayıda, farklı viral varyantları klonlama etkili yüksek kapasiteli replikatif virüs seçtiği, kronik olarak enfekte olmuş bireylerin incelenerek ve burada daha uygun s uygun bu nedenle oldukça emek yoğun değildir. Ancak, akut enfekte olmuş kişide, genel olarak 1-2 varyantları mevcut bulunmaktadır ve bu nedenle, in vitro seçme basınçları ile geri kazanılan virüs stokunun doğasını eğriltme riskini ortadan kaldırır, in vitro replikasyon kapasitesi daha doğru bir şekilde değerlendirilmesi için sağlar. İkincisi, bu yöntem bir alt tip B türetilmiş omurgası içine alt tip C gag-yanlısı dizileri birleştirilmesini gerektirir ve analiz içine omurga uyumsuzluk önyargıları tanıtmak olabilir. Bu sınırlamalar nedeniyle, dizilerin sayıda oluşan herhangi bir muhtemel yanlılığı üstesinden gelmek için analiz edilmelidir.
Burada alternatif bir deneysel bir yaklaşımı açıklamakalt tip C, akut olarak enfekte olmuş bireylerdeki türetilen sekansları üzerinde çalışmaya uygun ACH. Bu alt tip C Proviral omurgasına MJ4 olarak HIV-1 alt tip C enfekte bireylerin akut enfeksiyon zaman noktalarında elde edilen gag geninin katılması, bir kısıtlayıcı enzim bazlı klonlama stratejisi kullanın. Gag genleri klonlamak için ortak bir omurga olarak MJ4 kullanılması alt tipi C türetilmiş sekansların analizi için çok önemlidir. MJ4 nedeniyle omurga ve gag geni arasındaki alt tipi uyumsuzluk önyargı tanıtmak için daha az muhtemel olacağını, böylece primer izolat 38 türetilmiştir edilir ve. Proviral 293T hücreleri doğrudan transfekte edilmesi gereken yapıların ve klonlanmış gag dizisi ile aynı olan bir klonal virüs stokunun geri kazanımı için Buna ek olarak, kısıtlama enzim bazlı klonlama bölgesinin bir yaklaşım sağlar.
Aşağıda sunulan yöntem türetilmiş Gag-MJ4 alt tip C çoğaltma kapasitesini değerlendirmek için yüksek verimli bir yöntemdirsimerik virüslerin. 293T hücreleri içine transfeksiyonu basittir ve virüsün geri üç gün sürer. In vitro replikasyon kapasitesi. Brockman et al tarafından oluşturulan aynı CEM-CCR5 göre T-hücresi hattında 37 tahlil, ancak başarılı bir çoğaltma için gerekli olan önemli değişiklikler protokolü kullanarak alt tip C MJ4 simerik virüslerin. PBMC'ler daha çok, uygun bir T-hücresi çizgisinin kullanımı, yüksek tahlil üretilebilirliğine ile test edilecek olan alt tip C MJ4-simerik virüslerin çok sayıda sağlar. Son olarak, üstte yüzen madde içindeki virüs miktarının tayini için bir radyo-etiketli ters transkriptaz deneyi kullanılarak ticari olarak temin edilebilen ELISA kitleri kullanılarak P24 den daha düşük maliyetlidir. Ayrıca, aynı tahlilde, hem zayıf ve son derece kopyalayan virüs tespit etmek ve suşlar arasında çoğaltma ince farklar tespit edilmesi için önemli olan bir yüksek dinamik aralık verir.
Sonuç olarak, burada sunulan yöntem için izin verdiHIV-1 alt tip C türetilen öğürme dizilerinin çoğaltma kapasitesi derinlemesine çalışma akut Zambiya bireylerin enfekte ve yazılı olarak, ayrıca C popülasyonları enfekte diğer subtipini incelemek için genişletilmiş olabilir. Farklı Gag izolatlar arasında çoğaltma kapasitelerde varyasyon yüksek derecede gözlenmiştir. Ayrıca, üç yıllık bir süre üzerinde 39 CD4 + düşüş iletilen Gag çoğaltma kapasitesine ve set noktası viral yük arasındaki yanı sıra ile istatistiksel bir ilişki göstermek için başardık. Bu sonuçlar, bu tür çoğaltma kapasitesi nasıl bulaşan viral özellikleri, çalışmanın önemini vurgulamak, erken enfeksiyon sırasında patogenezi etkilemeye konak bağışıklık sistemi ile etkileşim ve etkin bir aşı müdahaleleri gibi tedaviler geliştirilmesinde ayrılmaz olacaktır.
Nedeniyle uzunluk ve bu protokol, teknik doğası nedeniyle, kimerik Gag-MJ4 plasmidlerin kurulmasında her ikisi için önemli bir unsur olarak ayrıca viral replikasyon kapasitesinin ölçümü için olan birkaç adım vardır. Bu protokolde belirtilen MJ4 yabancı öğürme genlerin tanıtımı için kısıtlama enzim bazlı klonlama stratejisi önceden kullanılan rekombinasyon bazlı yöntemlere göre çok sayıda avantajları olmasına rağmen kritik adımlar tam uyulmadığı takdirde, protokol teknik ol…
The authors have nothing to disclose.
The investigators thank all the volunteers in Zambia who participated in this study and all the staff at the Zambia Emory HIV Research Project in Lusaka who made this study possible. The investigators would like to thank Jon Allen, Smita Chavan, and Mackenzie Hurlston for technical assistance and sample management. We would also like to thank Dr. Mark Brockman for his discussions and generous donation of the GXR25 cells.
This study was funded by R01 AI64060 and R37 AI51231 (EH) and the International AIDS Vaccine Initiative. This work was made possible in part by the generous support of the American people through the United States Agency for International Development (USAID). The contents are the responsibility of the study authors and do not necessarily reflect the views of USAID or the United States Government. This work also was supported, in part, by the Virology Core at the Emory Center for AIDS Research (Grant P30 AI050409). DC and JP were supported in part by Action Cycling Fellowships. This work was supported in part by the Yerkes National Primate Research Center base grant (2P51RR000165-51). This project was also funded in part by the National Center for Research Resources P51RR165 and is currently supported by the Office of Research Infrastructure Programs/OD P51OD11132.
Name of the Reagent | Company | Catalogue number | Comments |
PCR reagents | |||
GOF: 5' ATTTGACTAGCGGAGGCTAGAA 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
VifOR: 5' TTCTACGGAGACTCCATGACCC 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
GagInnerF1: 5' AGGCTAGAAGGAGAGAGATG 3' |
IDT DNA | Custom Oligo | 25nmol, standard desalt |
BclIDegRev2: 5' AGTATTTGATCATAYTGYYTYACTTTR 3' |
IDT DNA | Custom Oligo | 25nmol, standard desalt |
MJ4For1b: 5' CGAAATCGGCAAAATCCC 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
MJ4Rev: 5' CCCATCTCTCTCCTTCTAGC 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
BclIRev: 5' TCTATAAGTATTTGATCATACTGTCTT 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
GagF2: 5' GGGACATCAAGCAGCCAT 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
For3: 5' CTAGGAAAAAGGGCTGTTGGAAATG 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
GagR6: 5' CTGTATCATCTGCTCCTG 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
Rev3: 5' GACAGGGCTATACATTCTTACTAT 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
Rev1: 5' AATTTTTCCAGCTCCCTGCTTGCCCA 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
CoolRack PCR 96 XT | Biocision | BCS-529 | |
CoolRack M15 | Biocision | BCS-125 | |
Nuclease free water | Fisher | SH30538FS | Manufactured by Hyclone |
QIAamp Viral RNA Mini Kit | Qiagen | 52906 | |
Simport PCR 8 Strip Tubes, Blue (Flat Cap) | Daigger | EF3647BX | |
SuperScript III one-step RT-PCR system | Life Technologies/Invitrogen | 12574035 | |
Phusion Hot-start II DNA polymerase | Fisher | F-549L | |
PCR Nucleotide Mix | Roche | 4638956001 | |
Agarose, high gel strength | Fisher | 50-213-128 | |
TAE 10X | Life Technologies/Invitrogen | AM9869 | |
Promega 1kb DNA ladder | Fisher | PRG5711 | Manufactured by Promega |
Sybr Safe DNA Gel Stain, 10000x | Life Technologies/Invitrogen | S33102 | |
Wizard SV Gel and PCR Clean-Up System | Promega | A9282 | |
Razor blades, single-edged | Fisher | 12-640 | Manufactured by Surgical Design |
Thermocycler, PTC-200 | MJ Research | ||
Microbiology & Cloning reagents | |||
LB Agar, Miller | Fisher | BP1425-2 | |
LB Broth, Lennox | Fisher | BP1427-2 | |
Sterile 100mm x 15mm polystyrene petri dishes | Fisher | 08-757-12 | |
Ampicillin sodium salt | Sigma-Aldrich | A9518-5G | |
Falcon 14ml Polypropylene round-bottom tubes | BD Biosciences | 352059 | |
NgoMIV restriction endonuclease | New England BioLabs | R0564L | |
BclI restriction endonuclease | New England BioLabs | R0160L | |
HpaI restriction endonuclease | New England BioLabs | R0105L | |
T4 DNA Ligase, 5U/μL | Roche | 10799009001 | |
JM109 competent cells, >10^8 cfu/μg | Promega | L2001 | |
PureYield plasmid miniprep system | Promega | A1222 | |
Safe Imager 2.0 Blue Light Transilluminator | Invitrogen | G6600 | |
Microfuge 18 centrifuge | Beckman Coulter | 367160 | |
Cell culture reagents | |||
Amphyl cleaner/disinfectant | Fisher | 22-030-394 | |
Fugene HD, 1 mL | VWR | PAE2311 | Manufactured by Promega |
Hexadimethrine bromide (Polybrene) | Sigma-Aldrich | H9268-5G | |
Costar Plates, 6-well, flat | Fisher | 07-200-83 | Manufactured by Corning Life |
Costar Plates, 24-well, flat | Fisher | 07-200-84 | Manufactured by Corning Life |
Costar Plates, 96-well, round | Fisher | 07-200-95 | Manufactured by Corning Life |
Flasks, Corning filter top/canted neck, 75 cm^2 | Fisher | 10-126-37 | |
Flasks, Corning filter top/canted neck, 150 cm^2 | Fisher | 10-126-34 | Manufactured by Corning Life |
Conical Tubes, 50ml, blue cap | Fisher | 14-432-22 | Manufactured by BD Biosciences |
Conical Tubes, 15ml, blue cap | Fisher | 14-959-70C | Manufactured by BD Biosciences |
Trypsin-EDTA | Fisher | MT25052CI | Manufactured by Mediatech |
RPMI, 500 ml | Life Technologies/Invitrogen | 11875-119 | |
DMEM, 500 ml | Life Technologies/Invitrogen | 11965-118 | |
Penicillin/Streptomycin/Glutamine, 100X | Life Technologies/Invitrogen | 10378-016 | |
PBS with magnesium and calcium, 500ml | Life Technologies/Invitrogen | 14040-133 | |
PBS without magnesium and calcium | Life Technologies/Invitrogen | 20012-050 | |
Sarstedt tubes, assorted colors | Sarstedt | 72.694.996 | |
Reservoir Trays for Multichannel, 55ml | Fisher | 13-681-501 | |
DEAE-Dextran | Fisher | NC9691007 | |
Corning 96 well clear V bottom tissue culture treated microplate | Fisher | 07-200-96 | Manufactured by Corning Life |
HEPES, 1M Buffer Solution | Life Technologies/Invitrogen | 15630-080 | |
FBS, Defined, 500 ml | Fisher | SH30070 03 | |
X-gal | VWR | PAV3941 | Manufactured by Promega |
Glutaraldehyde, Grade II, 25% in H2O | Sigma-Aldrich | G6257-100ML | |
1M Magnesium chloride solution | Sigma-Aldrich | M1028-100ML | |
Formaldehyde solution, for molecular biology, 36.5% | Sigma-Aldrich | F8775-500ML | |
Potassium hexacyanoferrate(II) trihydrate | Sigma-Aldrich | P9387-100G | |
Potassium hexacyanoferrate(III) | Sigma-Aldrich | P8131-100G | |
Allegra X15-R centrifuge | Beckman Coulter | 392932 | |
TC10 automated cell counter | Bio-Rad | 1450001 | |
VistaVision inverted microscope | VWR | ||
Reverse-Transcriptase Quantification Assay reagents | |||
dTTP, [α-33P]- 3000Ci/mmol, 10mCi/ml, 1 mCi | Perkin-Elmer | NEG605H001MC | |
1M Tris-Cl, pH 8.0 | Life Technologies/Invitrogen | 15568025 | Must be adjusted to pH 7.8 with KOH |
2M potassium chloride (KCl) | Life Technologies/Invitrogen | AM9640G | Adjust to 1M solution |
0.5M EDTA | Life Technologies/Invitrogen | 15575-020 | |
Nonidet P40 | Roche | 11333941103 | |
Polyadenylic acid (Poly rA) potassium salt | Midland Reagent Co. | P-3001 | |
Oligo d(T) primer | Life Technologies/Invitrogen | 18418-012 | |
Dithiothreitol (DTT) | Sigma-Aldrich | 43815-1G | |
SR, Super Resolution Phosphor Screen, Small | Perkin-Elmer | 7001485 | |
Corning Costar Thermowell 96 well plate model (M) Polycarbonate | Fisher | 07-200-245 | Manufactured by Corning Life |
Corning 96 Well Microplate Aluminum Sealing Tape, Nonsterile | Fisher | 07-200-684 | Manufactured by Corning Life |
DE-81 anion exchange paper | Whatman | 3658-915 | |
Trisodium citrate dihydrate | Sigma-Aldrich | S1804-1KG | |
Sodium Chloride | Fisher | S671-3 | |
Autoradiography cassette | Fisher | FB-CA-810 | |
Cyclone storage phoshpor screen | Packard |