Here, we present a protocol describing how to i) assemble a self-replicating vector using the CyanoGate modular cloning toolkit, ii) introduce the vector into a cyanobacterial host by conjugation, and iii) characterize transgenic cyanobacteria strains using a plate reader or flow cytometry.
Cyanobacteria are a diverse group of prokaryotic photosynthetic organisms that can be genetically modified for the renewable production of useful industrial commodities. Recent advances in synthetic biology have led to development of several cloning toolkits such as CyanoGate, a standardized modular cloning system for building plasmid vectors for subsequent transformation or conjugal transfer into cyanobacteria. Here we outline a detailed method for assembling a self-replicating vector (e.g., carrying a fluorescent marker expression cassette) and conjugal transfer of the vector into the cyanobacterial strains Synechocystis sp. PCC 6803 or Synechococcus elongatus UTEX 2973. In addition, we outline how to characterize the performance of a genetic part (e.g., a promoter) using a plate reader or flow cytometry.
Cyanobacteria are autotrophic bacteria that can be used for the biosynthesis of a wide variety of natural and heterologous high value metabolic products1,2,3,4,5,6. Several hurdles still need to be overcome to expand their commercial viability, most notably, the relatively poor yields compared to heterotrophic bio-platforms (e.g., Escherichia coli and yeast)7. The recent expansion of available genetic engineering tools and uptake of the synthetic biology paradigm in cyanobacterial research is helping to overcome such challenges and further develop cyanobacteria as efficient biofactories8,9,10.
The main approaches for introducing DNA into cyanobacteria are transformation, conjugation and electroporation. The vectors transferred to cyanobacteria by transformation or electroporation are "suicide" vectors (i.e., integrative vectors that facilitate homologous recombination), while self-replicating vectors can be transferred to cyanobacteria by transformation, conjugation or electroporation. For the former, a protocol is available for engineering model species amenable to natural transformation11. More recently, a modular cloning (MoClo) toolkit for cyanobacteria called CyanoGate has been developed that employs a standardized Golden Gate vector assembly method for engineering using natural transformation, electroporation or conjugation12.
Golden Gate-type assembly techniques have become increasingly popular in recent years, and assembly standards and part libraries are now available for a variety of organisms13,14,15,16,17. Golden Gate uses type IIS restriction enzymes (e.g., BsaI, BpiI, BsmBI, BtgZI and AarI) and a suit of acceptors and unique overhangs to facilitate directional hierarchical assembly of multiple sequences in a "one pot" assembly reaction. Type IIS restriction enzymes recognize a unique asymmetric sequence and cut a defined distance from their recognition sites to generate a staggered, "sticky end" cut (typically a 4 nucleotide [NT] overhang), which can be subsequently exploited to drive ordered DNA assembly reactions15,18. This has facilitated the development of large libraries of modular Level 0 parts (e.g., promoters, open reading frames and terminators) defined by a common syntax, such as the PhytoBricks standard19. Level 0 parts can then be readily assembled into Level 1 expression cassettes, following which more complex higher order assemblies (e.g., multigene expression constructs) can be built in an acceptor vector of choice12,15. A key advantage of Golden Gate-type assembly techniques is their amenability to automation at high-throughput facilities, such as DNA foundries20,21, which can allow for the testing of complex experimental designs that cannot easily be achieved by manual labor.
CyanoGate builds on the established Plant MoClo system12,15. To incorporate a new part into CyanoGate, the part sequence must first be domesticated, i.e., "illegal" recognition sites for BsaI and BpiI must be removed. In the case of a part coding for an open reading frame (i.e., a coding sequence, CDS), recognition sites can be disrupted by generating synonymous mutations in the sequence (i.e., changing a codon to an alternative that encodes for the same amino acid residue). This can be achieved by a variety of approaches, ranging from DNA synthesis to polymerase chain reaction (PCR) amplification-based strategies such as Gibson assembly22. Depending on the expression host being used, care should be taken to avoid the introduction of rare codons that could inhibit the efficiency of translation23. Removing recognition sites in promoter and terminator sequences is typically a riskier endeavor, as modifications may affect function and the part might not perform as expected. For example, changes to putative transcription factor binding sites or the ribosome binding site within a promoter could alter strength and responsiveness to induction/repression. Likewise, modifications to key terminator structural features (e.g., the GC rich stem, loop and poly-U tail) may change termination efficiency and effect gene expression24,25. Although several online resources are available to predict the activity of promoter and terminator sequences, and inform whether a proposed mutation will impact performance26,27, these tools are often poor predictors of performance in cyanobacteria28,29,30.. As such, in vivo characterization of modified parts is still recommended to confirm activity. To assist with the cloning of recalcitrant sequences, CyanoGate includes a low copy cloning acceptor vector based on the BioBrick vector pSB4K512,16,31. Furthermore, a "Design and Build" portal is available through the Edinburgh Genome Foundry to help with vector design (dab.genomefoundry.org). Lastly, and most importantly, CyanoGate includes two Level T acceptor vector designs (equivalent to Level 2 acceptor vectors)15 for introducing DNA into cyanobacteria using suicide vectors, or broad host-range vectors capable of self-replication in several cyanobacterial species32,33,34.
Here we will focus on describing a protocol for generating Level T self-replicating vectors and the genetic modification of Synechocystis PCC 6803 and Synechococcus elongatus UTEX 2973 (Synechocystis PCC 6803 and S. elongatus UTEX 2973 hereafter) by conjugation (also known as tri-parental mating). Conjugal transfer of DNA between bacterial cells is a well described process and has been previously used for engineering cyanobacterial species, in particular those that are not naturally competent, such as S. elongatus UTEX 297335,36,37,38,39,40,41. In brief, cyanobacterial cultures are incubated with an E. coli strain carrying the vector to be transferred (the "cargo" vector) and vectors (either in the same E. coli strain or in additional strains) to enable conjugation ("mobilizer" and "helper" vectors). Four key conditions are required for conjugal transfer to occur: 1) direct contact between cells involved in DNA transfer, 2) the cargo vector must be compatible with the conjugation system (i.e., it must contain a suitable origin of transfer (oriT), also known as a bom (basis of mobility) site), 3) a DNA nicking protein (e.g., encoded by the mob gene) that nicks DNA at the oriT to initiate single-stranded transfer of the DNA into the cyanobacterium must be present and expressed from either the cargo or helper vectors, and 4) the transferred DNA must not be destroyed in the recipient cyanobacterium (i.e., must be resistant to degradation by, for example, restriction endonuclease activity)35,42. For the cargo vector to persist, the origin of replication must be compatible with the recipient cyanobacterium to allow for self-replication and proliferation into daughter cells post division. To aid with conditions 3 and 4, several helper vectors are available through Addgene and other commercial sources that encode for mob as well as several methylases to protect from native endonucleases in the host cyanobacterium43. In this protocol, conjugation was facilitated by an MC1061 E. coli strain carrying mobilizer and helper vectors pRK24 (www.addgeneorg/51950) and pRL528 (www.addgene.org/58495), respectively. Care must be taken when choosing the vectors to be used for conjugal transfer. For example, in the CyanoGate kit the self-replicating cargo vector pPMQAK1-T encodes for a Mob protein12. However, pSEVA421-T does not44, and as such, mob must be expressed from a suitable helper vector. The vectors used should also be appropriate to the target organism. For example, efficient conjugal transfer in Anabaena sp. PCC 7120 requires a helper vector that protects the mobilizer vector against digestion (e.g., pRL623, which encodes for the three methylases AvaiM, Eco47iiM and Ecot22iM)45,46.
In this protocol we further outline how to characterize the performance of parts (i.e., promoters) with a fluorescent marker using a plate reader or a flow cytometer. Flow cytometers are able to measure fluorescence on a single cell basis for a large population. Furthermore, flow cytometers allow users to "gate" the acquired data and remove background noise (e.g., from particulate matter in the culture or contamination). In contrast, plate readers acquire an aggregate fluorescence measurement of a given volume of culture, typically in several replicate wells. Key advantages of plate readers over cytometers include the lower cost, higher availability and typically no requirement for specialist software for downstream data analyses. The main drawbacks of plate readers are the relatively lower sensitivity compared to cytometers and potential issues with the optical density of measured cultures. For comparative analyses, plate reader samples must be normalised for each well (e.g., to a measurement of culture density, typically taken as the absorbance at the optical density at 750 nm [OD750]), which can lead to inaccuracies for samples that are too dense and/or not well mixed (e.g., when prone to aggregation or flocculation).
As an overview, here we demonstrate in detail the principles of generating Level 0 parts, followed by hierarchical assembly using the CyanoGate kit and cloning into a vector suitable for conjugal transfer. We then demonstrate the conjugal transfer process, selection of axenic transconjugant strains expressing a fluorescent marker, and subsequent acquisition of fluorescence data using a flow cytometer or a plate reader.
1. Vector assembly using the Plant MoClo and CyanoGate toolkits
NOTE: Before proceeding with vector assembly, it is strongly recommended that users familiarize themselves with the vector level structures of the Plant and CyanoGate MoClo systems12,15.
2. E. coli transformation and vector purification
3. Generation of mutants by conjugation
NOTE: Here, a protocol for conjugal transfer of a self-replicating cargo vector into Synechocystis PCC 6803 or S. elongatus UTEX 297311,47 is described. This protocol is applicable to other model species (e.g., S. elongatus PCC 7942 and Synechococcus sp. PCC 7002). All work with cyanobacteria (and associated buffer preparations) should be done under sterile conditions in a laminar flow hood.
4. Promoter characterization
NOTE: Here a standard approach is described for analyzing the strength of a promoter part by measuring the expression levels of a fluorescent marker (eYFP) following a 72 h growth period using either a plate reader or a flow cytometer12.
5. Genomic DNA extraction from cyanobacteria
NOTE: The protocol below uses a commercial DNA extraction kit (Table of Materials).
6. Agarose gel electrophoresis
7. Colony PCR
8. Preparation of BG11 medium and plates
To demonstrate the Golden Gate assembly workflow, an expression cassette was assembled in the Level 1 position 1 (Forward) acceptor vector (pICH47732) containing the following Level 0 parts: the promoter of the C-phycocyanin operon Pcpc560 (pC0.005), the coding sequence for eYFP (pC0.008) and the double terminator TrrnB (pC0.082)12. Following transformation of the assembly reaction, successful assemblies were identified using standard blue-white screening of E. coli colonies (Figure 3). The eYFP expression cassette in the Level 1 vector and the End-Link 1 vector (pICH50872) were then assembled into a Level T acceptor vector (pPMQAK1-T) to give the vector cpcBA-eYFP (Figure 4A). The assembled cpcBA-eYFP vector was verified by restriction digestion (Figure 4B).
Successful conjugal transfer of cpcBA-eYFP or the empty pPMQAK1-T vector (i.e., a negative control lacking the eYFP expression cassette) resulted in the growth of up to several hundred colonies on the membrane for Synechocystis PCC 6803 and S. elongatus UTEX 2973 after 7−14 days and 3−7 days, respectively (Figure 5). Individual colonies were picked and streaked onto fresh BG11+Kan50 agar plates; 2−3 re-streaks were required to generate axenic cultures.
As expected for the strong Pcpc560 promoter51, the values for normalised eYFP fluorescence from the plate reader and eYFP fluorescence per cell from the flow cytometer were high compared to the negative control (Figure 6 and Figure 7). Fluorescence values were higher in S. elongatus UTEX 2973 than in Synechocystis PCC 680312.
Figure 1: Overview of the Golden Gate assembly process in CyanoGate. Assembly of a gene expression cassette is shown, starting from amplification of a sequence of interest from template DNA to assembly in a Level T vector (parts are not drawn to scale). (A) Design of forward and reverse primers for amplification of a CDS1 part from template DNA (e.g., genomic or plasmid DNA). The locations of the BpiI restriction sites and overhangs required for insertion into the acceptor vector (i.e., 5′ and 3′ of the template sequence) are highlighted in red and blue, respectively. The letter "n" denotes that any NT can be used at this position. The annealing regions of the primers with the DNA template and their recommended melting temperatures (Tm) are indicated. (B) Level 0 assembly of the PCR product into the Level 0 CDS1 acceptor vector pICH41308. The sequence that will be excised by BpiI and ligated into the acceptor vector is highlighted in blue. (C) Level 1 assembly of a gene expression cassette containing three Level 0 parts (Pro + 5U, CDS1 and 3U + Ter) into the Level 1 position 1 (forward) acceptor vector pICH47732 using BsaI. (D) Level T assembly of the Level 1 assembly and End-Link 1 (pICH50872, called "Level M End-link 1" in Engler et al.15) into a Level T acceptor vector (e.g., pPMQAK1-T) using BpiI. (E) The final assembled Level T vector. Abbreviations: AmpR, ampicillin resistance cassette; CarbR, carbenicillin resistance cassette; CDS1, coding sequence in the Level 0 syntax15; EL1, End-Link 1 part; KanR, kanamycin resistance cassette; lacZα, β-galactosidase expression cassette; SpecR, spectinomycin resistance cassette. Please click here to view a larger version of this figure.
Figure 2: A PCR-based domestication strategy for removal of an illegal type IIS restriction site. (A) Schematic diagram showing two primer pairs (in green and orange, respectively) for modifying a BpiI site (GAAGAC) to GAGGAC in a protein coding DNA sequence intended for assembly into the CDS1 Level 0 acceptor vector (pICH41308). Note that modification preserves the codon for glutamic acid (Glu) (i.e., GAA to GAG). Although the BpiI site is shown in frame with the start codon, this approach will work even if the site is not in frame (i.e., as long as the site is disrupted, and the protein sequence preserved). The locations of the BpiI restriction sites and overhangs in the primers are highlighted in red and blue, respectively. The DNA template and the translated protein sequence is highlighted in yellow. The annealing regions of the primers with the DNA template and their recommended melting temperatures (Tm) are indicated. The orange pair is used to amplify the 5′ end of the sequence with overhangs AATG and TGAA (fragment 1), while the green pair is used to amplify the 3′ end with overhangs TGAA and GCTT (fragment 2). Before ordering the primers, the fidelity of the TGAA fusion overhang for Fragment 1 and 2 was carefully checked52. Poorly designed fusion overhangs can lead to assembly failure (i.e., no colonies following transformation; Figure 5) or false positives (e.g., truncated or erroneous assemblies). The latter can be resolved be screening a larger number of white colonies to identify a correctly assembled construct. (B) Amplicons of fragments 1 and 2 after restriction with BpiI during Golden Gate assembly. (C) The domesticated sequence assembled into the Level 0 CDS1 acceptor vector. Please click here to view a larger version of this figure.
Figure 3: Blue-white colony screening of E. coli transformants following Golden Gate assembly. The plates shown contain LB agar (1% [w/v]) supplemented with X-Gal, IPTG and antibiotics at appropriate concentrations. (A) No colonies, suggesting a failed assembly reaction and/or E. coli transformation. (B) Mostly blue colonies, indicating a successful assembly, but that the efficiency of restriction enzyme used in the assembly reaction was low. (C) Mostly white colonies, indicative of a typical, successful assembly reaction. (D) No blue colonies, indicating very efficient assembly. Please click here to view a larger version of this figure.
Figure 4: Verification of an assembled Level T vector by restriction digestion. The vectors were digested with HindIII and BamHI. (A) Sequence map of empty pPMQAK1-T acceptor vector (CT.0) and Level T assembly (cpcBA-eYFP) showing components of the eYFP expression cassette (Pcpc560-eYFP-TrrnB). The positions of the restriction sites for HindIII and BamHI are indicated. Following double digestion, the predicted sizes of the DNA fragments are indicated: (1) 5,847 bp, (2) 2,004 bp, (3) 30 bp, (4) 374 bp, (5) 1,820 bp, (6) 1,289 bp, and (7) 156 bp. (B) An agarose gel (0.8% [w/v]) run at 125 V for 60 min loaded with the digested Level T assembly (cpcBA-eYFP) showing bands 1, 5 and 6, the digested empty pPMQAK1-T acceptor vector (CT.0) showing bands 1 and 2 and a DNA ladder (Table of Materials). Note that bands 3, 4 and 7 were too small to visualize on the gel. Please click here to view a larger version of this figure.
Figure 5: Growth of transgenic Synechocystis PCC 6803 colonies following successful conjugation. Examples of membranes following incubation on BG11+Kan50 agar plates are shown. (A) Overgrowth following very efficient conjugation-the Synechocystis PCC 6803 colonies have developed into a lawn with no individual colonies. (B) A good conjugation efficiency showing several hundred individual colonies after 12 days. (C) Growth of an axenic strain after 14 days following several rounds of re-streaking onto a fresh BG11+Kan50 agar plate. Absence of bacterial contamination indicated that the Synechocystis PCC 6803 transconjugant was axenic. Please click here to view a larger version of this figure.
Figure 6: Representative growth data and normalized eYFP fluorescence values using a plate reader. (A) Growth comparison of strains carrying cpcBA-eYFP or the empty pPMQAK1-T vector (CT.0, negative control) in Synechocystis PCC 6803 and S. elongatus UTEX 2973. Values are the means ± SE from four biological replicates. Synechocystis PCC 6803 and S. elongatus UTEX 2973 were cultured for 72 h at 30 °C with continuous light (100 µmol photons m-2s-1) and 40 °C with 300 µmol photons m-2s-1, respectively. (B) Normalized eYFP fluorescence values for Synechocystis PCC 6803 or S. elongatus UTEX 2973 conjugated with cpcBA-eYFP at 72 h. Values are the means ± SE from four biological replicates. Please click here to view a larger version of this figure.
Figure 7: Representative eYFP fluorescence values using a flow cytometer. (A) Forward (FSC-H) and side (SSC-H) scatter plot from the "blank" medium solution (BG11 and PBS). (B) Scatter plot for a Synechocystis PCC 6803 sample (right). The circle indicates the selected region gating the cyanobacteria population from the remainder of the sample signal. (C) Histogram of the gated region for a strain carrying the empty pPMQAK1-T vector (CT.0, negative control). (D) Histogram of the gated region for a strain carrying cpcBA-eYFP. (E) eYFP fluorescence values per cell in Synechocystis PCC 6803 and S. elongatus UTEX 2973 at 72 h. Fluorescence from the negative control has been subtracted. Values are the means ± SE from four biological replicates. Please click here to view a larger version of this figure.
No. | Vector ID | Name | Description | 5' overhang | 3' overhang |
1 | pICH41233 | Pro | Promoter | GGAG | TACT |
2 | pICH41295 | Pro + 5U | Promoter and 5ˈ untranslated region | GGAG | AATG |
3 | pAGM1251 | Pro + 5U (f) | Promoter and 5ˈ untranslated sequence for N terminal fusions | GGAG | CCAT |
4 | pICH41246 | 5U | 5ˈ untranslated region | TACT | CCAT |
5 | pAGM1263 | 5U (f) | 5′ untranslated sequence for N terminal fusions | TACT | CCAT |
6 | pICH41246 | 5U + NT1 | 5ˈ untranslated region and N terminal coding region | TACT | CCAT |
7 | pAGM1276 | NT1 | N terminal tag or localisation signal | CCAT | AATG |
8 | pICH41258 | SP | Signal peptide | AATG | AGGT |
9 | pICH41258 | NT2 | N terminal tag or localisation signal | AATG | AGGT |
10 | pAGM1287 | CDS1 ns | Coding region without stop codon | AATG | TTCG |
11 | pICH41308 | CDS1 stop | Coding region with stop codon | AATG | GCTT |
12 | pAGM1299 | CDS2 ns | Coding region – without start and stop codon | AGGT | TTCG |
13 | pICH41264 | CDS2 stop | Coding region – without start and with stop codon | AGGT | GCTT |
14 | pAGM1301 | CT | C terminal tag or localization signal | TTCG | GCTT |
15 | pICH53388 | 3U | 3ˈ untranslated region | GCTT | GGTA |
16 | pICH53399 | Ter | Terminator | GGTA | CGCT |
17 | pICH41276 | 3U + Ter | 3ˈ untranslated region and terminator | GCTT | CGCT |
18 | pICH41331 | CGM | Acceptor for complete gene cassettes | GGAG | CGCT |
19 | pCA0.002 | Pro (low copy) | Promoter, low copy number acceptor (pSC101 ori) | GGAG | TACT |
20 | pCA0.001 | Pro TSS | Promoter truncated to the transcription start site | GGAG | TAGC |
21 | Direct to Level 1 | srRNA | Small regulatory RNA (for translational silencing) | TAGC | GTTT |
22 | Direct to Level 1 | sgRNA | Single guide RNA (for CRISPRi) | TAGC | GTTT |
23 | pICH41295 | UP FLANK | Flanking sequence upstream of target homologous recombination site | GGAG | AATG |
24 | pICH41276 | DOWN FLANK | Flanking sequence downstream of target homologous recombination site | GCTT | CGCT |
Table 1: A list of available Level 0 acceptor vectors and overhangs. Vectors 1−18 are from the Plant MoClo kit15. Vectors 19−22 are from the CyanoGate kit12. For srRNA and sgRNA parts, synthesized sequences or PCR products are assembled directly into Level 1 acceptor vectors. Vectors 23−24 are from the Plant MoClo kit that have been re-purposed for transformation by homologous recombination using the CyanoGate kit.
BpiI assembly components (Level 0, T) | BsaI assembly components (Level 1) | ||
50−100 ng of acceptor vector | 50−100 ng of acceptor vector | ||
For each vector/part to insert, use a 2:1 ratio of insert: acceptor vector. | For each vector/part to insert, use a 2:1 ratio of insert: acceptor vector. | ||
2 µL 10 mM ATP (Table of Materials) | 2 µL 10 mM ATP (Table of Materials) | ||
2 µL buffer G (buffer for BpiI/BsaI) | 2 µL buffer G (buffer for BpiI/BsaI) | ||
2 µL BSA (10x) (Table of Materials) | 2 µL BSA (10x) (Table of Materials) | ||
10 units BpiI (1 µL10 U/µL BpiI, Table of Materials) | 10 units BsaI (1 µL 10 U/µL BsaI, Table of Materials) | ||
Bring to 20 µL with dH2O. | Bring to 20 µL with dH2O. | ||
200 units T4 DNA ligase (1 µL 200 U/µL, Table of Materials) | 200 units T4 DNA ligase (1 µL 200 U/µL, Table of Materials) | ||
Thermocycler protocol (Level 0, T) | Thermocycler protocol (Level 1) | ||
37 °C for 10 min | cycle x 5 | 37 °C for 10 min | cycle x 5 |
16 °C for 10 min | 16 °C for 10 min | ||
37 °C for 20 min | 37 °C for 20 min | ||
65 °C for 10 min | 65 °C for 10 min | ||
16 °C (hold) | 16 °C (hold) |
Table 2: Protocols for Golden Gate assemblies in Levels 0, 1 and T. Assembly in Level 0 and Level T acceptor vectors uses restriction enzyme BpiI (left). Assembly in Level 1 acceptor vectors uses restriction enzyme BsaI (right). This table has been adapted from Vasudevan et al.12.
Primer No. | Sequence (5'-3') | Length (bp) | Description |
L0T forward | GTCTCATGAGCGGATACATA TTTGAATG |
28 | For amplification from Level 0 and Level T |
L1 reverse | GAACCCTGTGGTTGGCATGC ACATAC |
26 | For amplification from Level 1 |
L1 forward | CTGGTGGCAGGATATATTGT GGTG |
24 | For amplification from Level 1 |
L0T reverse | TTGAGTGAGCTGATACCGCT | 20 | For amplification from Level 0 and Level T |
Table 3: List of primers for PCR validation or sequencing of Level 0, 1 and T vectors.
Golden Gate assembly has several advantages compared to other vector assembly methods, particularly in terms of scalability20,21. Nevertheless, setting up the Golden Gate system in a lab requires time to develop a familiarity with the various parts and acceptor vector libraries and overall assembly processes. Careful planning is often needed for more complex assemblies or when performing a large number of complex assemblies in parallel (e.g., making a suite of Level T vectors containing multiple gene expression cassettes). We recommend first listing all the gene expression cassette combinations required and then mapping the workflow from Level 0 to Level T in silico. During this process, users should consider the Level 1 "Dummy" parts available in the Plant MoClo kit that allow for the assembly of non-sequential Level 1 vectors in Level T (e.g., Level 1 position 1 and position 3 vectors can be assembled together with "Dummy" part Level 1 position 2), which can reduce the overall number of assembly reactions and cloning steps required15.
DNA synthesis is typically the simplest method for building new Level 0 parts. However, when cloning is required (e.g., from plasmids or genomic DNA), optimizing the design of the primers used for amplification is important for maximizing the efficiency of subsequent Level 0 vector assembly. The two most critical steps in primer design are: 1) checking that the correct overhangs are included and are in the appropriate orientation for the forward and reverse primers (Figure 1 and Table 1), and 2) ensuring that the length of the primer sequence that anneals to the template is sufficiently long (18−30 bp) and that the Tm value for this sequence (ideally 58−62°C) is similar for the primer pair (Figure 1A). If a sequence requires domestication, several strategies are available. For short sequences (e.g., <200 bp), a pair of long forward and reverse primers can be designed in which the 3′ ends anneal to each other (i.e., an overlap of >20 bp) and form a double stranded sequence following amplification. For longer sequences, separate fragments of the sequence can be amplified that remove illegal restriction sites and then assembled using a Golden Gate assembly approach (Figure 2). If assembly efficiency with PCR products is poor, individual fragments of a Level 0 sequence can be cloned into the Level 1 universal acceptor vector (pAGM1311), validated, and then assembled together into the appropriate Level 0 acceptor vector15. A 2:1 insert:acceptor vector molar ratio is recommended for efficient Golden Gate assembly. However, for assemblies of only 2-3 vectors (e.g., two Level 0 parts and a Level 1 acceptor vector), combining ~100 ng of each regularly typically results in successful assemblies. The efficiency of assemblies does tend to decrease as the number of vectors used per reaction increases, resulting in a reduction in total numbers of white colonies following transformation (Figure 3).
Prior to conjugation, validation of finalized Level T vectors by restriction digest and PCR is recommended. Conjugal DNA transfer is a well stablished technique for cyanobacterial strains, including those that are not naturally transformable41,45. Important steps in the conjugation protocol include: 1) careful handling of the helper E. coli strain following overnight growth (e.g., avoid vortexing)35, 2) taking care to completely remove traces of the antibiotics used to grow helper and cargo E. coli strains, 3) an appropriate incubation period for the mixture of cargo and helper strains and cyanobacteria (e.g., a longer incubation period was critical for S. elongatus UTEX 2973), and 4) the initial transfer period of the cell mixture on membranes in LB-BG11 agar plates lacking antibiotics for 24 h.
Isolated cyanobacterial colonies should develop on the membrane within two weeks for Synechocystis PCC 6803 and S. elongatus UTEX 2973, otherwise it is likely that conjugation has failed. Several modifications to the protocol could then be tested, including 1) using a cyanobacterial culture with a higher starting density (e.g., OD750 = 1.5−2); 2) increasing the incubation period before transfer to the membrane; and 3) extending the initial incubation period on the membrane from 24 h to 48 h (i.e., to allow more time for the expression of the antibiotic resistance gene on the transferred vector). If conjugation still fails, alternative methods such as electroporation could be tried53. Confirming a transgenic cyanobacterial strain is axenic is important prior to further experimentation. Finally, it is good practice to confirm the size of the heterologous vector in the transgenic cyanobacterial strain. The latter requires DNA extraction (section 5), transformation into E. coli and selection (section 2.1), and vector validation (section 2.4).
The outlined promoter characterization protocol uses small culture volumes (i.e., 2 mL) as a means of achieving a high throughput screening methodology. Larger volumes could be used depending on the photobioreactor space available, which would help to mitigate culture evaporation issues. If high throughput screening with small culture volumes is required, it is essential to have high humidity within the growth chamber to inhibit evaporation. Evaporation during a growth experiment can be detrimental to the accuracy and validity of sample measurements. Do check culture volumes during and after the experiment to confirm how much evaporation has occurred.
For plate reader measurements, it is important to measure cultures at low densities, ideally OD750 < 1, to ensure the acquisition of reliable and reproducible growth and fluorescence data. A linear relationship between cell number and OD750 is observed only within a specific range54. To establish this range, we recommend performing a serial dilution (e.g., from OD750 = 0.1−1.0) using a known transformant where eYFP fluorescence has been confirmed. Plotting absolute fluorescence against normalized fluorescence (eYFP fluorescence/OD750) will help to identify the linear working range of culture densities. Several plate readers include a "gain" feature to modify the sensitivity of the fluorescence detector. In this case, the gain value should be set to an appropriate level before beginning the experiment and not changed between different experimental runs or the data will not be directly comparable.
Although the operation of different flow cytometers will vary between manufacturers, it is important to take a blank reading of the medium solution to facilitate the identification and gating of the target cyanobacterial population from any background signal in the medium (Figure 7A,B). Following this, subtraction of the fluorescence value of the negative control sample (e.g., a wild type strain) will help to remove native autofluorescence (Figure 7C,D). The photomultiplier tube (PMT) voltage parameter in a flow cytometer has a similar function to the gain in a plate reader, i.e., increasing or decreasing the sensitivity of the detector to the intensity of the fluorescence signal. As with the plate reader, PMT voltage should be set to an appropriate level before beginning the experiment55. Once set, the PMT voltage value should be maintained between different experimental runs or the data will not be directly comparable.
The authors have nothing to disclose.
The authors are grateful to the PHYCONET Biotechnology and Biological Sciences Research Council (BBSRC) Network in Industrial Biotechnology and Bioenergy (NIBB) and the Industrial Biotechnology Innovation Centre (IBioIC) for financial support. GARG, AASO and AP acknowledge funding support from the BBSRC EASTBIO CASE PhD program (grant number BB/M010996/1), the Consejo Nacional de Ciencia y Tecnología (CONACYT) PhD program, and the IBioIC-BBSRC Collaborative Training Partnership (CTP) PhD program, respectively. We thank Conrad Mullineaux (Queen Mary University of London), and Poul Eric Jensen and Julie Annemarie Zita Zedler (University of Copenhagen) for plasmid vector and protocol contributions and advice.
5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal) | Thermo Fisher Scientific | R0404 | Used in 2.1.3. |
Adenosine 5′-triphosphate (ATP) disodium salt | Sigma-Aldrich | A2383 | Used in Table 2. |
Agar (microbiology tested) | Sigma-Aldrich | A1296-500g | Used in 8.3. |
Agarose | Bioline | BIO-41026 | Used in 6. |
Attune NxT Flow Cytometer | Thermo Fisher Scientific | – | Used in 4.3.1. |
Bovine Serum Albumin (BSA) | Sigma-Aldrich | A2153 | Used in Table 2. |
BpiI (BbsI) | Thermo Fisher Scientific | ER1011 | Used in Table 2. |
BsaI (Eco31I) | Thermo Fisher Scientific | ER0291 | Used in Table 2. |
Carbenicillin disodium | VWR International | A1491.0005 | Used in 2.1.3. |
Corning Costar TC-Treated flat-bottom 24 well plates | Sigma-Aldrich | CLS3527 | Used in 4.1.3. |
Dimethyl Sulfoxide (DMSO) | Thermo Fisher Scientific | BP231-100 | Used in 3.6.2. |
DNeasy Plant Mini Kit | Qiagen | 69104 | DNA extraction kit. Used in 5. |
FLUOstar Omega Microplate reader | BMG Labtech | – | Used in 4.2.2. |
GeneJET Plasmid Miniprep Kit | Thermo Fisher Scientific | K0503 | Plasmid purification kit. Used in step 2.3.2. |
Glass beads (0.5 mm diameter) | BioSpec Products | 11079105 | Used in 5.2. |
Glycerol | Thermo Fisher Scientific | 10021083 | Used in 2.3.1, 3.6.2. |
Isopropyl-beta-D-thiogalactopyranoside (IPTG) | Thermo Fisher Scientific | 10356553 | Used in 2.1.3. |
Kanamycin sulphate (Gibco) | Thermo Fisher Scientific | 11815-024 | Used in 2.1.3. |
Membrane filters (0.45 μm) | MF-Millipore | HAWP02500 | Used in 3.3.7 |
Microplates, 96-well, flat-bottom (Chimney Well) µCLEAR | Greiner Bio-One | 655096 | Used in 4.2.1. |
Monarch DNA Gel Extraction Kit | New England Biolabs | T1020S | Used in 1.1.2.2. |
Monarch PCR DNA Cleanup Kit | New England Biolabs | T1030 | DNA purification kit. Used in 1.1.2.3. |
Multitron Pro incubator with LEDs | Infors HT | – | Shaking incubator with white LED lights. Used in 4.1.4. |
MyTaq DNA Polymerase | Bioline | BIO-21108 | Used in 7.1. |
NanoDrop One | Thermo Fisher Scientific | ND-ONE-W | Used in 2.3.3. |
One Shot TOP10 chemically competent E. coli | Thermo Fisher Scientific | C404010 | Used in 2.1.1. |
Phosphate buffer saline (PBS) solution (10X concentrate) | VWR International | K813 | Used in 4.3.2. |
Q5High-Fidelity DNA Polymerase | New England Biolabs | M0491S | Used in 1.1.2.1. |
Quick-Load 1 kb DNA Ladder | New England Biolabs | N0468S | Used in Figure 4. |
Screw-cap tubes (1.5 ml) | Starstedt | 72.692.210 | Used in 3.6.3 |
Spectinomycin dihydrochloride pentahydrate | VWR International | J61820.06 | Used in 2.1.3. |
Sterilin Clear Microtiter round-bottom 96-well plates | Thermo Fisher Scientific | 612U96 | Used in 4.3.1. |
T4 DNA ligase | Thermo Fisher Scientific | EL0011 | Used in Table 2. |
TissueLyser II | Qiagen | 85300 | Bead mill. Used in 5.2. |