Here, we present a reliable and straightforward two-dimensional (2D) coculture system for studying the interaction between tumor cells and bone marrow adipocytes, which reveals a dual effect of melanoma cell-derived factors on the bone marrow adipocytes differentiation and also poses a classic method for the mechanistic study of bone metastasis.
The crosstalk between bone marrow adipocytes and tumor cells may play a critical role in the process of bone metastasis. A variety of methods are available for studying the significant crosstalk; however, a two-dimensional transwell system for coculture remains a classic, reliable, and easy way for this crosstalk study. Here, we present a detailed protocol that shows the coculture of bone marrow adipocytes and melanoma cells. Nevertheless, such a coculture system could not only contribute to the study of cell signal transductions of cancer cells induced by bone marrow adipocytes, but also to the future mechanistic study of bone metastasis which may reveal new therapeutic targets for bone metastasis.
Bone metastases are widespread among advanced cancer patients, but a curative treatment is still unavailable. Beyond specializing in storing energy as fat, adipocytes can support tumor growth and metastasis in bone marrow and other organs1,2,3,4,5,6. Moreover, adipocytes play an essential role in regulating cancer cell biology7,8,9,10 and metabolism4,11,12,13,14,15,16, as well as in bone metastasis1,4,12. In the bone marrow niche, adipocytes can also affect the biological behavior of cancer cells4,6,17. The interplay between bone marrow adipocytes and cancer cells with osteotropism is significant for an understanding of bone metastasis. However, little is known.
Based on the current studies, various methods are applied to adipocytes, including two- or three-dimensional (2/3D) and ex vivo cultures17,18,19,20,21. Recently, Herroon et al. designed a new 3D-culture approach to study interactions of bone marrow adipocytes with cancer cells22. Although the 3D coculture is optimal for mimicking physiological interactions between adipocytes and cancer cells in vivo, it suffers from poor reproducibility22,23. In comparison to a 2D coculture system, a 3D coculture system may provide different cellular phenotypes, such as cell morphology21,22,24,25,26. Moreover, the ex vivo culture of isolated cancellous bone tissue fragments can lead to a robust outgrowth of adipocytes from cultured bone marrow cells17.
In contrast to these previous models, however, the 2D cell culture model remains a classic, reliable, and easy technique for quickly scanning candidate molecules and the phenotypes changed in either adipocytes or cancer cells in vitro1,4,6,12,15,27. To better understand the crosstalk between bone marrow adipocytes and melanoma cells, we provide a detailed protocol for a 2D coculture system of bone marrow adipocytes with melanoma cells.
NOTE: All cells used in this protocol should be grown for at least three generations after thawing from frozen stock cells.
1. Harvest Melanoma Cell-derived Factors
2. Induction of Bone Marrow Adipocytes by Melanoma Cell-derived Factors
3. Coculture of Bone Marrow Adipocytes with Melanoma Cells
4. qPCR Analysis of the Adipocyte-specific Gene Signature
In the bone marrow, adipocytes can appear in the tumor microenvironment1,13,33,34,35 at an early stage for supporting tumor progression through soluble factors or activating osteoclastogenesis6,12,36, especially in the context of obesity6,12 and/or aging37. Our previous studies1 have noted that the number of bone marrow adipocyte changes dramatically during the early stage of melanoma metastases to bone1. Indeed, the amounts of adipocytes accumulate in the tumor area and support the tumor cells' growth in the bone marrow when the mice fed with a high-fat diet6, suggesting that bone marrow adipocytes might play a significant role in the metastatic bone marrow niche37. However, the dynamic crosstalk of tumor cells and bone marrow adipocyte remains unclear. Therefore, we were dedicated to addressing this issue by the 2D coculture system of bone marrow adipocyte and melanoma cells.
Tumor-derived factors promote the differentiation of bone marrow adipocytes:
Figure 1a represents a typical workflow for inducing bone marrow adipocytes with tumor-conditioned medium (TCM). A representative experiment indicates 14F1.1 cells, plated as single cells at a density of 5 x 104 cells per well in the presence of an adipogenic induction medium in the first 2 days, and then maintained within the adipogenic maintenance medium (with or without TCM) for 6–8 days. Mature adipocyte contains lipid droplets; therefore, the differentiated adipocytes can be easily identified by Oil Red O staining (Figure 1b) and quantified by qPCR with an adipocyte-specific gene signature (Figure 1c).
Overload of melanoma cells induces de-differentiation in bone marrow adipocytes:
Tumor cells can modify the environment to survive, especially under hypoxic conditions1,4,6. To mimic a tumor-burden secondary effect on a bone marrow adipocyte, we performed the 2D coculture system with a continued increase of melanoma cell number in the upper inserts (Figure 2a). Figure 2b shows that the lipid storage in the adipocytes is deprived to a greater extent at the highest density of melanoma cells (106 cells/well) compared with the deprivation at the lowest frequency of melanoma cells (103 cells/well). Figure 2c presents a gene profiling of these adipocytes in the adipocytes in the coculture. Compared with the coculture with the lowest density of melanoma cells, pref-1 level increased obviously, and the expression of Leptin, adiponectin, FABP4, CEBPβ, and PPARγ was decreased, which suggests that the tumor-burden secondary effect can be attributed to the de-differentiation process in the adipocytes. Besides, an overload of tumor cells could induce necrosis in adipocytes38.
In summary, we observed an opposite melanoma cell-driven effect on bone marrow adipocytes by soluble factors.The opposite effect on bone marrow adipocytes is of high interest, suggesting that bone marrow adipocytes are dynamic regulators of the tumor cell metastasize to bone marrow.
Figure 1: Tumor-derived factors promote an adipocyte differentiation. (a) This panel shows a schematic view of the experimental setting which uses 14F1.1 cell lines and a melanoma-derived conditioned medium. (b) This panel shows the imaging of a differentiated bone marrow adipocyte. (c) This panel shows the analysis of an adipocyte-specific gene signature by qPCR. TCM = tumor-conditioned medium. qPCR: quantitative polymerase chain reaction. Scale bar = 50 µm. This figure has been modified from Wang et al.1. Please click here to view a larger version of this figure.
Figure 2: Tumor-burden effects on adipocyte. (a) This panel shows a schematic view of the experimental setting: a coculture of 14F1.1 cell lines and melanoma cells. (b) This panel shows the imaging of a bone marrow adipocyte in the coculture system. (c) This panel shows a gene profiling of adipocytes by qPCR. qPCR: quantitative polymerase chain reaction. Scale bar = 50 µm. This figure has been modified from Wang et al.1. Please click here to view a larger version of this figure.
Primers | ||
Gene name | Forward sequence (5' to 3') | Reverse sequence (5' to 3') |
PPARγ | CTGATGCACTGCCTATGAGC | GGGTCAGCTCTTGTGAATGG |
CEBPα | AAG AGC CGC GAC AAG GC | GTC AGC TCC AGC ACC TTG TG |
CEBPβ | CAACCTGGAGACGCAGCACAAG | GCTTGAACAAGTTCCGCAGGGT |
FABP4 | TGAAATCACCGCAGACGACAGG | GCTTGTCACCATCTCGTTTTCTC |
Leptin | ATC TGA AGC AAG CCA TCA GC | CCA GTC ACC AGA GGT CAA GC |
Pref-1 | GACACTCGAAGCTCACCTGG | GGAAGGCTGGGACGGGAAAT |
Adiponectin | GCG ATA CAT ATA AGC GGC TTC T | GCA GGC ATC CCA GGA CAT C |
Table 1: Table of primers used for qPCR.
Cocultures with inserts have been widely used to study cell-to-cell interactions. The 2D coculture system is an effective way to observe how the two parts crosstalk in vitro, by which we here showed two different cancer cell-driven effects on bone marrow adipocytes. Many labs have utilized this method to investigate the crosstalk between adipocytes and cancer cells6,12,27,39.
In general, therefore, a 2D coculture is the best straightforward approach to the cell-to-cell crosstalk study.However, when it comes to preparing an undifferentiated cell line for further research, there are some unique challenges. In the protocol described here, the health and functional status of the bone marrow stromal cell is very critical for the adipocytes differentiation. The protocol could be modified to replace the 14F1.1 cells with primary bone marrow mesenchymal stem cells. Furthermore, the pre-incubation of the 14F1.1 cells in the adipogenic induction medium for several days is another critical step. Without this pre-incubation, the bone marrow stromal cells will fail to differentiate into adipocytes, which has been detected in our and others' studies40. These phenomena also explain why some similar protocols may result in different or even opposite effects and highlight the importance of such an easy, repeatable, and detailed protocol for the crosstalk study of tumor cells and bone marrow adipocytes.
Although the 2D coculture may lose some critical information in comparison to 3D or ex vivo cultures, it remains easy to be standardized, monitored, and eventually manipulated for further use20,21,41. A future application of the technique may decide how an osteoblast changes when it is cocultured with cancer cells.
The authors have nothing to disclose.
We thank Dov Zipori (The Weizmann Institute of Science, Rehovot, Israel) kindly for providing us the murine bone marrow stromal cell line 14F1.1. This study was supported by grants from the Chinese National Natural Science Foundation (Nos. 81771729) and the Yongchuan Hospital of Chongqing Medical University (Nos. YJQN201330; YJZQN201527).
DMEM | Invitrogen Inc. | 11965092 | |
Fetal Bovine Serum | Invitrogen Inc. | 16000–044 | |
Phosphate Buffered Saline | Invitrogen Inc. | 14190-144 | |
Insulin | Sigma-Aldrich | 91077C | |
3-isobutyl-1-methyl-xanthine | Sigma-Aldrich | I5879 | |
Dexamethasone | Sigma-Aldrich | D4902 | |
Oil Red o | Sigma-Aldrich | O0625 | |
24-well plate | Corning | CLS3527 | |
Transwell insert | Millipore | MCHT24H48 | |
Penicillin/Streptomycin | Invitrogen | 15140-122 | |
isopropanol | Sigma-Aldrich | I9516 | |
0.25% trypsin | Thermo Scientific | 25200056 | |
hemocytometer | Bio-Rad | 1450016 | |
Culture incubator | Thermo Scientific | ||
50ml falcon | Corning | CLS430828 | |
Clean Bench | Thermo Scientific | – | |
Microscopy | Olympus | – | |
200 μL pipet tips | BeyoGold | FTIP620 | |
1000 mL pipet tips | BeyoGold | FTIP628 |