Gene-targeting mutagenesis is now possible in a wide range of organisms using genome editing techniques. Here, we demonstrate a protocol for targeted gene mutagenesis using transcription activator like effector nucleases (TALENs) in Astyanax mexicanus, a species of fish that includes surface fish and cavefish.
Identifying alleles of genes underlying evolutionary change is essential to understanding how and why evolution occurs. Towards this end, much recent work has focused on identifying candidate genes for the evolution of traits in a variety of species. However, until recently it has been challenging to functionally validate interesting candidate genes. Recently developed tools for genetic engineering make it possible to manipulate specific genes in a wide range of organisms. Application of this technology in evolutionarily relevant organisms will allow for unprecedented insight into the role of candidate genes in evolution. Astyanax mexicanus (A. mexicanus) is a species of fish with both surface-dwelling and cave-dwelling forms. Multiple independent lines of cave-dwelling forms have evolved from ancestral surface fish, which are interfertile with one another and with surface fish, allowing elucidation of the genetic basis of cave traits. A. mexicanus has been used for a number of evolutionary studies, including linkage analysis to identify candidate genes responsible for a number of traits. Thus, A. mexicanus is an ideal system for the application of genome editing to test the role of candidate genes. Here we report a method for using transcription activator-like effector nucleases (TALENs) to mutate genes in surface A. mexicanus. Genome editing using TALENs in A. mexicanus has been utilized to generate mutations in pigmentation genes. This technique can also be utilized to evaluate the role of candidate genes for a number of other traits that have evolved in cave forms of A. mexicanus.
Understanding the genetic basis of trait evolution is a critical research goal of evolutionary biologists. Considerable progress has been made in identifying loci underlying the evolution of traits and pinpointing candidate genes within these loci (for example1-3). However, functionally testing the role of these genes has remained challenging as many organisms used for studying the evolution of traits are not currently genetically tractable. The advent of genome editing technologies has greatly increased genetic manipulability of a wide range of organisms. Transcription activator-like effector nucleases (TALENs) and clustered regularly interspaced short palindromic repeats (CRISPRs) have been used to generate targeted mutations in genes in a number of organisms (for example4-11). These tools, applied to an evolutionarily relevant system, have the potential to revolutionize the way evolutionary biologists study the genetic basis of evolution.
Astyanax mexicanus is a species of fish that exists in two forms: a river-dwelling surface form (surface fish) and multiple cave-dwelling forms (cavefish). A. mexicanus cavefish evolved from surface fish ancestors (reviewed in12). Populations of cavefish have evolved a number of traits including loss of eyes, decrease or loss of pigmentation, increased numbers of taste buds and cranial neuromasts, and changes in behavior such as loss of schooling behavior, increased aggression, changes in feeding posture and hyperphagia13-19. Cavefish and surface fish are interfertile, and genetic mapping experiments have been performed to identify loci and candidate genes for cave traits1,20-26. Some candidate genes have been tested for a functional role in contributing to cave traits in cell culture1,19, in model organisms of other species21 or by overexpression27 or transient knockdown using morpholinos28 in A. mexicanus. However, each of these methods has limitations. The ability to generate mutant alleles of these genes in A. mexicanus is critical for understanding their function in the evolution of cavefish. Thus, A. mexicanus is an ideal candidate organism for application of genome editing technologies.
Here we outline a method for genome editing in A. mexicanus using TALENs. This method can be used to evaluate mosaic injected founder fish for phenotypes and for isolating lines of fish with stable mutations in genes of interest29.
All animal procedures were in accordance with the guidelines of the National Institutes of Health and were approved by the Institutional Animal Care and Use Committee at Iowa State University and the University of Maryland.
1. TALEN Design
2. TALEN Assembly (Modified from the TALEN Kit Protocol)33,34
For additional details and troubleshooting, see the protocol34.
3. mRNA Transcription of TALENs
4. Inject Astyanax mexicanus Embryos with TALEN mRNA
5. Phenotype Founder Fish and Evaluate TALEN Efficiency
6. Screen for Germline Transmission
Note: A. mexicanus reach sexual maturity at 4-8 months.
TALEN pair injections result in binding of the RVDs to specific DNA nucleotides and thus dimerization of FokI domains, resulting in double stranded breaks39 which can be repaired through non-homologous end joining (NHEJ). NHEJ often introduces errors that result in insertions or deletions (indels). Indels can be identified by amplifying the region surrounding the TALEN target site and digesting the resulting amplicon with a restriction enzyme that cuts within the TALEN spacer region. Alleles without an indel will digest while alleles containing indels that change the restriction enzyme target sequence will not digest, producing a restriction enzyme resistant band (Figure 2).
TALEN injections can likely result in biallelic gene mutations in A. mexicanus29. Thus, some phenotypes may be assessed in founder fish. For example, we evaluated pigmentation in surface fish injected with TALENs targeting oca2, the gene hypothesized to be responsible for albinism in multiple albino populations of cavefish1,28. We found albino patches in oca2 TALEN-injected fish not present in uninjected fish29 (Figure 3).
For many experiments, it is desirable to have mutant lines of fish for evaluating phenotypes. Founder fish with transmitted mutant alleles can be identified by genotyping progeny from crosses of founder fish to wild type fish (Figure 4).
Figure 1. Needle for injecting mRNA. Photograph of a micropipette prior to being broken used for injecting TALEN mRNA into single celled embryos. Please click here to view a larger version of this figure.
Figure 2. TALEN efficiency for Oca2. 306 bp PCR products from exon 9 of oca2 in Astyanax mexicanus were examined for loss of the restriction enzyme site when different amounts of TALEN mRNA were injected29. The amplicon from a control embryo was digested while a portion of the amplicon was resistant to restriction digest in the pools of 10 TALEN injected embryos. Restriction enzyme digest resistant bands from embryos injected with TALEN mRNA targeted oca2 have been shown to contain indels29. Note that increasing concentrations of mRNA injected results in increased TALEN efficiency (more undigested DNA). Lanes with "-" are undigested, lanes with "+" are digested with restriction enzyme. Please click here to view a larger version of this figure.
Figure 3. Phenotyping founder fish for changes in pigmentation. (A) Control uninjected surface A. mexicanus. (B) Patch lacking melanophores in a founder surface fish injected with 400 pg TALEN mRNA targeting oca2 (arrow). Please click here to view a larger version of this figure.
Figure 4. Germline transmission of TALEN induced mutations. 306 bp PCR products from exon 9 of oca2 in A. mexicanus were examined for loss of the restriction enzyme site in pools of 10 F1 fish from an injected founder fish. The amplicon from a control embryo was digested while a portion of the amplicon was resistant to restriction digest in the pools of 10 F1 embryos. Restriction enzyme digest resistant bands from oca2 F1s have been shown to contain indels29. Lanes with "-" are undigested, lanes with "+" are digested with restriction enzyme. Please click here to view a larger version of this figure.
Reaction A | Reaction B | |||
amount | reagent | amount | reagent | |
4 µl | water | 10 µl | water | |
1 µl | pFUS_A | 1 µl | pFUS_B4 | |
1 µl | BsaI | 1 µl | BsaI | |
1 µl | BSA | 1 µl | BSA | |
1 µl | Ligase | 1 µl | Ligase | |
2 µl | 10x Ligase buffer | 1 µl | 10x Ligase buffer | |
1 µl | pNH1 | 1 µl | pNG1 | |
1 µl | pNH2 | 1 µl | pHD2 | |
1 µl | pNG3 | 1 µl | pNH3 | |
1 µl | pHD4 | 1 µl | pNI4 | |
1 µl | pHD5 | |||
1 µl | pHD6 | |||
1 µl | pNG7 | |||
1 µl | pHD8 | |||
1 µl | pNG9 | |||
1 µl | pHD10 |
Table 1. Example reaction assembly A and B for a TALEN containing RVDs NH-NH-NG-HD-HD-HD-NG-HD-NG-HD-NG-HD-NH-NI-NG.
primer name | sequence (5'-3') |
pCR8_F1 | ttgatgcctggcagttccct |
pCR8_R1 | cgaaccgaacaggcttatgt |
TAL_F1 | ttggcgtcggcaaacagtgg |
TAL_R2 | ggcgacgaggtggtcgttgg |
Table 2. PCR primers for colony PCR, from34.
reagent | amount |
Taq mastermix, 2x | 50 µl |
pCR8_F1 primer, 10 uM | 4 µl |
pCR8_R1 primer, 10 uM | 4 µl |
Nuclease-free water | 42 µl |
*Adjust master mix if a different taq is used |
Table 3. Master mix for 100 µl (15 µl/reaction) for colony PCR 1.
step | temperature (°C) | time (sec) |
1 | 95 | 120 |
2 | 95 | 30 |
3 | 55 | 30 |
4 | 72 | 105 |
5 | Go to step 2 for 30 cycles | |
6 | 72 | 300 |
Table 4. PCR program for colony PCR 1.
amount | reagent | concentration |
12 µl | water | |
1 µl | vector A | 100 ng/µl |
1 µl | vector B | 100 ng/µl |
1 µl | destination vector pT3Ts-gT | 50 ng/µl |
1 µl | final RVD (pLR-RVD) | 100 ng/µl |
1 µl | Esp3I | |
1 µl | ligase | |
2 µl | 10x Ligase buffer |
Table 5. Protocol for second assembly reactions.
step | temperature (°C) | time (sec) |
1 | 95 | 120 |
2 | 95 | 30 |
3 | 55 | 30 |
4 | 72 | 180 |
5 | Go to step 2 for 30 cycles | |
6 | 72 | 300 |
Table 6. PCR program for colony PCR 2.
heat | 290 |
pull | 150 |
velocity | 100 |
time | 150 |
These parameters are for a Flaming/Brown Micropipette Puller Model P-97 using a trough filament |
Table 7. Sample needle pulling program.
reagent | amount |
Taq mastermix, 2x | 12.5 µl |
gene specific forward primer, 10 µM | 1 µl |
gene specific reverse primer, 10 µM | 1 µl |
Nuclease-free water | 9.5 µl |
DNA | 1 µl |
*Adjust master mix if a different taq is used |
Table 8. Sample protocol for gene specific PCR.
step | temperature (°C) | time (sec) |
1 | 95 | 120 |
2 | 95 | 30 |
3 | 56 | 30 |
4 | 72 | 60 |
5 | Go to step 2 for 35 cycles | |
6 | 72 | 300 |
*adjust annealing temperature and extension time for specific primers and PCR product size |
Table 9. Sample PCR program for gene specific PCR.
Great strides have been made in recent years towards understanding the genetic basis of the evolution of traits. While candidate genes underlying the evolution of a number of traits have been identified, it has remained challenging to test these genes in vivo due to the lack of genetic tractability of most evolutionarily interesting species. Here we report a method for genome editing in A. mexicanus, a species used to study the evolution of cave animals. Genetic mapping studies1,21,23 and candidate gene approaches19,40 have identified a number of candidate genes for the evolution of traits in the cave form of A. mexicanus. The recent publication of the cavefish genome41 provides an additional powerful tool for identifying candidate genes for the evolution of cave traits. Testing the function of many of these candidate genes requires techniques to reduce gene expression. The only current option for studying reduced gene expression in A. mexicanus is by the use of morpholinos. However, morpholino gene knockdown is transient, limited to a few days post fertilization, and is not useful for studying traits in adult animals, such as behavioral differences between adult cave and surface fish like schooling17, hyperphagia19 and vibration attraction behavior42. Generation of loss of function alleles of genes, such as those that can be made using TALENs, will be critical for testing the role of candidate genes for these traits.
Methods have been developed for easy assembly of TALEN pairs33 and the detailed protocol for this method is available34. This protocol was optimized for zebrafish use by Bedell et al.7, using a different final destination vector, pT3Ts-goldyTALEN (pT3TS-gT). This vector allows for transcription of TALEN mRNA for injection into single celled zebrafish embryos. We have used this modified assembly method, explained in detail here, to assemble and transcribe TALENs for injection into A. mexicanus. We found that when injected into single-celled surface A. mexicanus embryos, as described within this protocol, we could mutate A. mexicanus genes29. For future research on candidate genes not described in this protocol, sequences can be found in the cavefish genome41 and used to identify TALEN target sites.
Critical for successful injections is high quality TALEN mRNA. Thus, checking for RNA quality by running a small amount of RNA on a gel prior to injection is important (Step 3.6). Other precautions for maintaining RNA integrity, such as freezing aliquots to avoid freeze thaws (Step 3.7), and maintaining sterile conditions by using clean water and RNAse-free tubes and tips during injections (Step 4), should be taken. An additional critical step to raising injected fish is cleaning out dead embryos following injection, as dead embryos can rapidly affect water quality. Thus, we remove dead embryos the morning following injections, and periodically for the next few days following injections to maintain healthy live embryos (Step 4.3.6).
TALEN mutagenesis in Astyanax mexicanus can be highly efficient; however, efficiency varies depending on the TALEN pair injected29. Increased mRNA concentrations can lead to increased toxicity and deformity and death of injected embryos. Thus, toxicity versus efficiency must be tested and balanced to determine the optimal concentration of mRNA to inject. For highly efficient TALEN pairs, phenotypes may be assessed in injected founder fish. For example, injection of TALENs targeting oca2 resulted in albino patches in surface fish29 (Figure 3). For other traits or genes, however, assessment of phenotypes in founder fish may be challenging due to subtly of the phenotype or low efficiency of the TALEN pair injected. Thus, for many applications it will be desirable to generate germline mutations in a gene of interest for analysis of the role of a candidate gene in a non-mosaic animal. Obtaining germline transmission of TALEN-induced mutations in A. mexicanus is possible29 (Figure 4). Thus, this technique can be applied to evaluate other candidate genes.
A few limitations to performing genetic manipulations in Astyanax mexicanus exist at this time. Surface and cavefish breed in the dark, late in the night. In a laboratory where it is not possible to reverse the light dark cycle, researchers must come in late at night to perform injections, as it is critical to inject immediately after spawning. Additionally, it is important to collect surface fish embryos in the dark, as light will affect spawning.
Other techniques, in particular the CRISPR/Cas system (reviewed in43), exist for genome editing and will likely be applicable to A. mexicanus. Indeed, protocols for guide RNA assembly exist that are rapid and easy44 and the protocol reported here can be modified for CRISPR/Cas injection. Additionally, new applications for genome editing are rapidly being developed, and many of these may prove useful for A. mexicanus researchers. For example, in zebrafish precise mutations have been made in a gene of interest by coinjecting TALENs with a single stranded oligo containing a mutation7. This technique could be useful for evaluating the role of cave alleles in generating cave phenotypes, such as the role of a missense mutation in certain cave alleles of mc4r in differences in metabolism observed between cavefish and surface fish19. TALENs have also been used to generate alleles of genes via homologous recombination that express fluorescent markers in patterns similar to the endogenous loci45. These methods could be used in A. mexicanus to evaluate subsets of cells or expression of candidate genes. The CRISPR/Cas system has been used in zebrafish to obtain tissue-specific gene knockout46. These techniques, applied to A. mexicanus, could be useful to evaluate the genetic basis of processes such as eye loss in cavefish. The lens plays a critical role in the process of eye loss in cavefish47 and the tissue-specific CRISPR/Cas system could be used to evaluate the role of candidate genes for eye loss specifically in the lens versus other tissues of the eye. These and other genome-editing techniques can be utilized in A. mexicanus in future studies to answer critical questions about the evolution of cave traits.
The authors have nothing to disclose.
This work was funded by the Department of Genetics, Development and Cell Biology and Iowa State University and by NIH grant EY024941 (WJ).Dr. Jeffrey Essner provided comments on the manuscript.
Equipment | |||
Thermocycler | |||
Injection station | |||
Gel apparatus | |||
Needle puller | |||
Nanodrop | |||
Name | Company | Catalog Number | Comments |
Supplies | |||
Note: As far as we know, supplies from different companies can be used unless otherwise indicated | |||
Golden Gate TALEN and TAL Effector Kit 2.0 | Addgene | Kit #1000000024 | |
Fisher BioReagents LB Agar, Miller (Granulated) | Fisher | BP9724-500 | |
Fisher BioReagents Microbiology Media: LB Broth, Miller | Fisher | BP1426-500 | |
Teknova TET-15 in 50% EtOH | Teknova (ordered through Fisher) | 50-843-314 | |
Spectinomycin Dihydrochloride, Fisher BioReagents | Fisher | BP2957-1 | |
Super Ampicillin (1000x solution) | DNA Technologies | 6060-1 | |
ThermoScientific X-Gal Solution, ready-to-use | Thermo Sci Fermentas Inc (Ordered through Fisher) | FERR0941 | |
IPTG, Fisher BioReagents | Fisher | BP1620-1 | |
Petri dishes | Fisher | 08-757-13 | |
BsaI | New England Biolabs (ordered through Fisher) | 50-812-203 | Use BsaI, not BsaI-HF (as described in the Golden Gate TALEN and TAL Effector Kit protocol) |
BSA | New England Biolabs | provided with restriction enzymes | |
10x T4 ligase buffer | Promega (ordered through Fisher) | PR-C1263 | |
GoTaq Green Master mix | Promega (ordered through Fisher) | PRM7123 | Other Taq can be used, but the reaction should be adjusted accordingly |
Quick ligation kit | New England Biolabs (ordered through Fisher) | 50-811-728 | We use Quick Ligase for all TALEN assembly reactions |
One Shot TOP10 Chemically Competent E.coli | Invitrogen | C4040-06 | Other chemically competent cells or homemade competent cells can be used |
Esp 3I | Thermo Sci Fermentas Inc (Ordered through Fisher) | FERER0451 | |
Plasmid-Safe ATP-dependent DNase | Epicentre (Ordered through Fisher) | NC9046399 | |
QIAprep Spin Miniprep Kit | Qiagen | 27106 | The Qiagen kit should be used for the initial plasmid preparation (as described in the Golden Gate TALEN and TAL Effector Kit protocol) |
QIAquick PCR Purification Kit | Qiagen | 28104 | |
GeneMate LE Quick Dissolve Agaraose | BioExpress | E-3119-125 | |
Sac I | Promega (Ordered through Fisher) | PR-R6061 | |
mMESSAGE mMACHINE T3 Transcription kit | Ambion | AM1348M | |
Rneasy MinElute Cleanup Kit | Qiagen | 74204 | |
NorthernMax-Gly Sample Loading Dye | Ambion (ordered through Fisher) | AM8551 | |
Eliminase | Decon (ordered through Fisher) | 04-355-32 | |
Fisherbrand Disposable Soda-Lime Glass Pasteur Pipets | Fisher | 13-678-6B | |
Standard Glass Capillaries | World Precision Instruments | 1B100-4 | |
Microcaps | Drummond Scientific Company | 1-000-0010 | |
Eppendorf Femtotips Microloader Tips for Femtojet Microinjector | Eppendorf (ordered through Fisher) | E5242956003 | |
Sodium hydroxide | Fisher | S318-500 | |
Tris base | Fisher | BP152-1 |