The zebrafish is a popular tool to model chronic kidney disease (CKD). However, their small size makes it impossible to evaluate renal function using traditional methods. We describe a fluorescent dye kidney clearance assay1 that allows quantitative analysis of zebrafish kidney function in CKD.
The zebrafish embryo offers a tractable model to study organogenesis and model human genetic disease. Despite its relative simplicity, the zebrafish kidney develops and functions in almost the same way as humans. A major difference in the construction of the human kidney is the presence of millions of nephrons compared to the zebrafish that has only two. However, simplifying such a complex system into basic functional units has aided our understanding of how the kidney develops and operates. In zebrafish, the midline located glomerulus is responsible for the initial blood filtration into two pronephric tubules that diverge to run bilaterally down the embryonic axis before fusing to each other at the cloaca. The pronephric tubules are heavily populated by motile cilia that facilitate the movement of filtrate along the segmented tubule, allowing the exchange of various solutes before finally exiting via the cloaca2-4. Many genes responsible for CKD, including those related to ciliogenesis, have been studied in zebrafish5. However, a major draw back has been the difficulty in evaluating zebrafish kidney function after genetic manipulation. Traditional assays to measure kidney dysfunction in humans have proved non translational to zebrafish, mainly due to their aquatic environment and small size. For example, it is not physically possible to extract blood from embryonic staged fish for analysis of urea and creatinine content, as they are too small. In addition, zebrafish do not produce enough urine for testing on a simple proteinuria ‘dipstick’, which is often performed during initial patient examinations. We describe a fluorescent assay that utilizes the optical transparency of the zebrafish to quantitatively monitor the clearance of a fluorescent dye, over time, from the vasculature and out through the kidney, to give a read out of renal function1,6-9.
The human kidney plays a crucial role in filtering metabolic waste from the blood and recovering required solutes to sustain cellular homeostasis. There are a number of human genetic diseases that cause kidney dysfunction. The most common inherited renal disease is autosomal dominant polycystic kidney disease (ADPKD) characterized by the development of fluid filled sacs within nephritic tubules; the damage caused by cystogenesis is detrimental to kidney function10. ADPKD has an occurrence of 1:800 – 1:1,000 and accounts for 8 – 10% of patients in end stage renal failure (ESRF)11. Several genes have been implicated to cause ADPKD including polycystin-1 (PKD1) and -2 (PKD2), accounting for approximately 85% and 15% of cases respectively12,13. Furthermore, the gene products for PKD1 and -2 localize to the cilium and are fundamental to ciliogenesis14,15. There is now a recognized family of human genetic disorders, known as the ciliopathies, which affect cilia function and result in CKD16.
The growing number of human genetic diseases affecting ciliary development and function is drawing global interest in this once considered vestigial organelle. The cilium, a hair-like cellular protrusion, is enriched with receptors and ion channels necessary for the transduction of key cell signaling events. The cilium consists of a microtubule-based axoneme, typically structured into nine radially arranged microtubule doublets with or without a central pair of singlet microtubules. The axonemal structure defines the type and mode of ciliary action. The 9+2 microtubule arrangement confers motility to the cilium where it is utilised in the movement of fluids across epithelial surfaces. The 9+0 configuration is non motile but is believed to mainly function in cellular signalling events17. Apart from CKD, the consequences of ciliary dysfunction are a set of characteristic ciliopathy features that include, obesity, retinal degeneration, polydactyly, and cognitive impairment16. However, CKD is amongst the most detrimental to the patient’s quality of life and therefore a major driving force behind the development of appropriate in vivo models for ciliary related CKD.
The zebrafish is an excellent model to understand the etiology of human genetic disease. Their quick development, production of large number of eggs, transparent tissue, and ex utero growth allows zebrafish developmental processes to be visualized and biological events manipulated with considerable ease. Genes can be genetically altered using the recent success of genome editing tools (CRISPR18 and TALENS19), knocked down using antisense morpholino technology20, or pharmacologically regulated by the addition of compounds to their aquatic environment. Indeed, zebrafish offer a platform to undertake experiments that are not permissive in other animal models. Whilst zebrafish are relatively simple vertebrates (compared to humans) they share many functionally conserved organs, genes, and signaling processes in common with humans. For example, the zebrafish kidney is remarkably similar in structure and function compared to humans21,22. However, unlike the mammalian kidney that develops through a succession of phases, each marked by a more developed kidney (pronephros, mesonephros, and metanephros), the embryonic zebrafish only develops a pronephros, the most immature form of a kidney. Whilst millions of nephrons can be found forming the building blocks of the mammalian kidney, the zebrafish embryo only possess two. The glomeruli, which allow for the initial blood filtrate, are fused at the midline just ventral to the aorta. Blood filters through the glomeruli into the pronephric tubules that run caudally along the axis, fusing prior to exit via the cloaca. The pronephric tubules are heavily ciliated with motile cilia that are permissive to the flow of filtrate towards the caudal exit3,4. This simple pronephric structure maintains zebrafish homeostasis through several weeks of larval growth where they eventually develop into a more complex mesonephros structure21. However, the zebrafish never develops a metanephros21. Despite the zebrafish idiosyncrasies, the zebrafish nephron is segmented with gene expression profiles equal to that observed in mammals and thus offers an unrivalled in vivo model for nephrogenesis3,22.
Routinely patients are tested for kidney function through a series of blood and urinary tests. Typically the blood is analyzed for dissolved salts, urea and creatinine. High levels of urea, creatinine and abnormal salt concentrations are indicative of problems with kidney function. Urinalysis using a colorimetric dipstick detects abnormal levels of protein, blood, pus, bacteria and sugar present in urine samples. Such tests normally require approximately 30 ml of urine or 5 – 10 ml of blood. It has been difficult to translate these types of assays to small in vivo model organisms, such as the zebrafish, mainly due to the impossible nature of collecting sufficient blood or urine to perform the assay. Here, we address the lack of appropriate zebrafish kidney function tests and describe an innovative technique for its study. By injecting a fluorescent dye into the blood stream we are able to monitor and individually quantify over time the filtration and excretion of fluorescent activity from the blood via the kidney. This method can be used to study kidney damage caused by disease, which we provide an example of.
Ethics Statement: Animal maintenance, husbandry, and procedures are defined and controlled by the Animals (Scientific Procedures) Act 1986. All animal experimentation has been carried out under licenses granted by the Home Secretary (PIL No. 70/7892) in compliance with Biological Services Management Group and the Biological Services Ethical Committee, SGUL, London, UK. All efforts were made to reduce the number of animals used and to refine both procedures and husbandry in order to minimize suffering and enhance welfare.
1. Preparation of Instruments, Anesthetic, and Fluorescent Dye
2. Zebrafish Husbandry and Pre-injection Treatment
3. Microinjection
NOTE: The pericardium encases the heart but is separated for protection and ease of cardiac movement by fluid within the pericardial cavity. The aim of this procedure is to inject RD into the pericardial cavity, this allows for rapid uptake of the dye to the vasculature system.
4. Imaging Acquisition
5. Image Processing
Bardet-Biedl syndrome (BBS) is a rare heterogeneous ciliopathy that affects approximately 1:160,000 people worldwide16. Patients present with a number of associated problems including polycystic kidneys, subsequently patients frequently require kidney dialysis or transplantation24. ESRF is the most common cause of death in BBS, with around 30% of patients developing CKD16. Currently, 20 non-related genes have been implicated in BBS with no published genotype-phenotype association. The BBS proteins share common protein localization domains within the cilium and basal bodies that, along with the patients’ characteristic traits, infer a ciliopathy diagnosis. BBS9 encodes Parathyoid Hormone-responsive B1 (PTHB1) protein that together with other BBS (BBS1, BBS2, BBS4, BBS5, BBS7, BBS8) proteins form the core BBSome complex responsible for the formation of the primary cilium24. Mutations in BBS9 account for 6% of BBS cases24. Furthermore, PTH has been implicated in kidney cyst formation through the promotion of renal epithelial cell proliferation, suggesting that loss of bbs9 function in zebrafish might display renal defects25. Previous reports using a bbs9 knockdown zebrafish model exclude a description of the kidney, presenting the opportunity to demonstrate the described kidney function assay26. Knockdown of bbs9 function was achieved in zebrafish by injecting, at the 1- to 4-cell stage, an antisense morpholino to block gene specific bbs9 translation and in parallel a standard negative control morpholino against an intronic mutation in human beta-globin (4 ng bbs9MO, sequence: GGCCTTAAACAAAGACATCCTGTAA and 4 ng control MO, sequence: CCTCTTACCTCAGTTACAATTTATA). We found that loss of bbs9 function resulted in 40% of embryos displaying pronephric cysts by 5 dpf, suggesting this was an appropriate model to analyze kidney function using the rhodamine dextran clearance assay. We observed that morphant fish have a significant reduction in their ability to clear the fluorescent dye after 24 hpi compared to controls (Figure 3) – con: 14.8 ± 1.2 SEM, n = 9; bbs9MO: 61.0 ± 10.3 SEM, n = 10; unpaired t-test P value: 0.002). To rule out the potential that reduced clearance could be due to reduced blood circulation, embryos were evaluated for heart beat and recirculating blood cells, both control and morphant fish had comparable heart rate and blood flow. These data indicate that kidney function is impaired in bbs9 morphants. Indeed, bbs9 morphant embryos develop cystic pronephric tubules concurrent with that observed in BBS patients.
Figure 1. Equipment preparation and set-up. (A) Borosilicate capillaries should be pulled for microinjection using an appropriate needle puller. The needle requires breaking with forceps (dashed line) to permit the RD to exit the needle, care should be taken not to break the needle too much rendering a needle that cannot be calibrated. Scale bar: 200 μm. (B) An agarose mould for embryo manipulation and orientation can be fashioned by gluing together glass slides and plastic pipettes. (C) The standard microinjection set-up. Please click here to view a larger version of this figure.
Figure 2. Microinjection of rhodamine dextran into the pericardial sac. (A) Calibrate the drop size to 10 increments (100 μm) on a 1 mm stage reticule. (B) Correct positioning of the needle (black arrows) into the crevasse marking the intersection between the caudal pharyngeal arch, yolk sac and heart will facilitate piercing the tissue (arrowhead). Scale bar: 200 μm. (C) Rhodamine dextran can be seen rapidly taken up by the whole vasculature (white arrows). 100 px2 regions of interests covering a centralized heart (yellow square) should be used to take measurements of the mean gray value and hence pixel/fluorescent intensity. Please click here to view a larger version of this figure.
Figure 3. Knockdown of bbs9 causes defective kidney function in zebrafish. (A) Embryos injected into the pericardium with rhodamine dextran at 3 hpi and 24 hpi, top and bottom two panels respectively, in either control or bbs9 morphant embryos. Arrowheads indicate the heart; arrow indicates the formation of a pronephric cyst. (B) Percentage fluorescent intensity remaining after 24 hpi in control versus bbs9MO embryos. Error bars show the standard error of the mean (SEM), **P ≤ 0.01. Please click here to view a larger version of this figure.
Zebrafish offer a valuable tool to model human genetic disease, their use as a scientific instrument for in vivo research have enabled detailed studies of the genetic breakdown of many biological systems, including the kidney. Much is now understood about how the zebrafish kidney develops and functions. The striking similarities to human nephrogenesis and homology with disease causing genes21 has illustrated how zebrafish have become fundamental in understanding how defects in gene function lead to the pathology of renal disease. Indeed, genetic manipulation can be effortlessly achieved in zebrafish using antisense morpholino knockdown technology or more advanced targeted genome editing tools such as TALENS or CRISPR. Creating knockdown or mutant models for suspected renal disease causing genes is the first step in understanding their involvement in the disease manifestation. To do this a reliable assay for kidney function is sought to indicate whether a candidate gene is likely responsible for the pathology observed in patients.
Kidney function tests are straightforward and relatively cheap to perform on humans, generally looking at levels of solutes present in the blood or urine. However, these methods are inapplicable in zebrafish due to its small size and aquatic habitat. The rhodamine dextran assay described here utilizes the ability of pronephric tubules to filter low molecular weight components from the blood. The podocytes positioned within the bowman’s capsule of the kidney, that envelopes the capillaries of the glomerulus, allow the free passing of small molecules such as water, ionic salts and glucose through a slit diaphragm27. The filtration slits further function to prevent the loss of macro proteins from the blood. Filtration is restricted for molecules above 5 kDa and almost completely blocked at the size of serum albumin28 (approximately 65 kDa). By injecting a fluorescent dextran dye of approximately 10 kDa, at a known concentration into the pericardial cavity, we are able to measure fluorescent intensity of the blood over time. Under normal conditions approximately 85% of initial fluorescence is lost from the blood, over a 24 hr period, through secretion via the kidney. One should note that the injection into pericardial space is only possible with low MW dextran that passes freely into the vasculature. Thus, this assay only gives a read-out for the rate of clearance for low molecular weight components and does not give any information about the efficacy of glomerular filtration. The latter can be assessed more directly using high molecular weight dyes over 70 kDa, requiring injection into the vasculature and not into pericardial space. Indeed, dextrans of various MWs can be used to further dissect kidney function28.
The zebrafish pronephric tubules are highly ciliated with motile cilia that facilitate the movement of filtrate toward the cloaca3,4. Defects in ciliary machinery have been implicated in kidney disease. BBS is a genetically heterogeneous, autosomal recessive disorder characterized by childhood-onset retinal degeneration, early onset obesity, cognitive impairment, polydactyly and renal malformation24. To date, 20 BBS genes (BBS1-20) have been identified. Disruption of bbs leads to renal cyst formation and defective pronephric function in zebrafish9. BBS9 interacts with other BBS proteins to form the BBSome responsible for appropriate ciliogenesis, mutations of which account for 6% of BBS cases24. Whilst a zebrafish bbs9 knockdown model has been reported, a description of the renal phenotype was lacking26. By knocking down bbs9 in zebrafish, using the morpholino approach, we demonstrate the use of the renal clearance assay as a method to determine kidney function in a kidney disease model. Here, we show that bbs9 morphant embryos display impeded fluorescent clearance from the blood stream, indicating that the kidney failed to remove low MW solutes. Thus, because of the involvement of bbs9 in ciliogenesis, and the role of pronephric cilia in facilitating filtrate movement, the observed kidney clearance in morphants is likely to be due to aberrant cilia function. This method represents a valuable tool for assessing kidney function in zebrafish disease models.
The authors have nothing to disclose.
Technical assistance provided by Jaipreet Bharj. This work was supported by grants from EU-FP7 (SYSCILIA -241955) and The Dutch Kidney Foundation (CP11.18).
Name of Material/ Equipment | Company | Catalog Number | Comments/Description |
P-97 SUTTER Flaming/Brown type micropipette puller | Intracel | P-97 | |
borosilicate standard wall capillaries | Harvard Apparatus | 30-0017 | |
Glass microscope slides | VWR International | 631-0109 | |
Epoxy Resin Glue | Evo-Stik | ||
Rhodamine B 10,000 MW labeled Dextran | Life technologies | D-1824 | |
N-Phenylthiourea | Sigma-Aldrich | P7629 | |
Methylene blue | Sigma-Aldrich | M9140 | |
Ethyl 3-aminobenzoate methanesulfonate salt | Sigma-Aldrich | A5040 | |
methylcellulose | Sigma-Aldrich | M0512 | |
air compressor | Jun-Air | OF302-15 | |
Picospritzer III | Parker Instruments | 051-0500-900 | |
compact 3-axis control micromanipulator | Marzhauser | MM33 | |
Dissecting stereo microscope | Nikon | SMZ1000 | |
microloader tips | Eppendorf | 5242956003 | |
Dumont #5 forceps | Sigma-Aldrich | F6521 | |
stage micrometer | Pyser- SGI | 02A00404 |