Cancer stem cells (CSCs) are implicated in tumor relapse due to chemoresistance. We have optimized a protocol for selection and expansion of CSCs from ovarian cancer cell lines. By treating cells with the chemotherapeutic cisplatin and culturing in a stem cell promoting media we enrich for non-adherent CSC cultures.
Cancer stem cells (CSCs) are defined as a subset of slow cycling and undifferentiated cells that divide asymmetrically to generate highly proliferative, invasive, and chemoresistant tumor cells. Therefore, CSCs are an attractive population of cells to target therapeutically. CSCs are predicted to contribute to a number of types of malignancies including those in the blood, brain, lung, gastrointestinal tract, prostate, and ovary. Isolating and enriching a tumor cell population for CSCs will enable researchers to study the properties, genetics, and therapeutic response of CSCs. We generated a protocol that reproducibly enriches for ovarian cancer CSCs from ovarian cancer cell lines (SKOV3 and OVCA429). Cell lines are treated with 20 µM cisplatin for 3 days. Surviving cells are isolated and cultured in a serum-free stem cell media containing cytokines and growth factors. We demonstrate an enrichment of these purified CSCs by analyzing the isolated cells for known stem cell markers Oct4, Nanog, and Prom1 (CD133) and cell surface expression of CD177 and CD133. The CSCs exhibit increased chemoresistance. This method for isolation of CSCs is a useful tool for studying the role of CSCs in chemoresistance and tumor relapse.
Resistance to chemotherapy is a major impediment to the treatment and cure of cancer. Ovarian cancer is the 5th leading cause of cancer-related deaths among women in the United States (American Cancer Society Facts and Figures 2013). Patients initially respond well to chemotherapy, but most patients relapse1. After relapse patients are treated with a variety of additional chemotherapy agents with very little benefit2. General properties of CSCs include unlimited proliferative capabilities, retention of an undifferentiated state, resistance to drug treatment, efficient DNA repair, and ability to generate malignant tumor cells with different phenotypes3. CSCs frequently exhibit expression of stem cell genes such as Nanog, Oct4, Sox2, Nestin, CD133, and CD117. CSCs often express elevated levels of ABCG2, and ALDH genes that may contribute to drug efflux and metabolism3,4.
The first definitive evidence for CSCs was demonstrated by isolating acute myeloid leukemia-initiating cells that were capable of self-renewal and tumor generation5. These leukemic stem cells expressed surface CD34 and generated leukemia in NOD/SCID (immunocompromised) mice5. Since then CSCs have been identified in many cancer types including leukemias/lymphomas, breast, bladder, colorectal, endometrial, sarcomas, hepatocellular carcinoma, melanomas, gliomas, ovarian, pancreatic, prostate, squamous cell carcinoma, and lung6. Therefore, being able to study this subtype of cancer cell is advantageous.
The goal of this study is to create a protocol for the selection and isolation of chemoresistant CSCs. Several methods have been reported for the isolation of CSCs from ovarian cancer cell lines. Non-adherent spheroids isolated from OVCAR-3, SKOV3, or HO8910 cultures demonstrate stem-like properties7,8. Isolation of CD133+ cells from OVCAR-3 cultures also yields CSCs. CSCs have also been selected in culture by treatment with chemotherapeutic agents. Treating tumor cell lines (OVCA433, Hey, and SKOV3 cells) with cisplatin and paclitaxel allows for the expansion and isolation of CSCs4,9. While culture of some cell types in CSC media leads to isolation of CSCs, SKOV3 cells did not survive culture in serum-free media or form sphere cells4. Therefore, treatment of cells with cisplatin and paclitaxel aided the expansion or isolation of this population4.
Using a modification of the procedure presented by Ma and colleagues4 we developed a method to isolate CSCs from the ovarian cancer cell lines. Our protocol is advantageous as it yields more viable cells while using less toxic chemotherapeutic agents. Cells are treated with cisplatin and subsequently grown in serum-free media supplemented with growth factors (stem cell media). We isolate the resulting non-adherent sphere cells and assay them for their expression of stem cell markers. This model enables the study of CSC properties and response to drug therapy.
1. Cell Culture and Fluorescent Labeling of Ovarian Cancer Cell Lines
2. Enrichment of Cancer Stem Cells
3. CSC Characterization via Gene Expression Analysis for Stem Cell Markers
Oct-4-FAM | Primer 1: 5′-CCCAAGGAATAGTCTGTAGAAGTG-3′ |
Primer 2: 5′-TGCATGAGTCAGTGAACAGG-3′ | |
FAM probe: 5′-CTTCCAAGC/ZEN/TGCCCACCTAACTTCT/3IABkFQ -3′ | |
Nanog-HEX | Primer 1: 5′-CCTTCTGCGTCACACCATT-3′ |
Primer 2: 5′-AACTCTCCAACATCCTGAACC-3′ | |
HEX probe: 5′-CTGCCACCT/ZEN.CTTAGATTTCATTCTCTGGT/3IABkFQ-3′ | |
GAPDH-CY5 | Primer 1: 5′-TGTAGTTGAGGTCAATGAAGGG-3′ |
Primer 2: 5′-ACATCGCTCAGACACCATG-3′ | |
CY5 probe: 5′-AAGGTCGGAGTCAACGGATTTGGTC/3IABRQSP-3′ | |
NESTIN-FAM | Primer 1: 5′-AGGACCTGAGCGATCTGG-3′ |
Primer 2: 5′-CGTTGGAACAGAGGTTGGAG-3′ | |
FAM probe: 5′-AACTTTTCA/ZEN/GTAGCCCGCAGCC/3IABkFQ -3′ | |
CD133-HEX | Primer 1: 5′-ACTCTCTCCAACAATCCATTCC-3′ |
Primer 2: 5′-AAACAATTCACCAGCAACGAG-3′ | |
HEX probe: 5′-ACAATCACT/ZEN/GAGCACTCTATACCAAAGCG/3IABkFQ-3 |
Table 1. Primers used for CSC characterization by QRT-PCR.
4. Analyzing CSCs for Cell Surface Markers CD117 and CD133
5. Analyzing CSCs for Therapeutic Response
To demonstrate that we isolated CSCs from epithelial ovarian cancer cell lines using cisplatin treatment, we first acquired images of the cell lines prior to treatment and after selection. We used light microscopy to capture images of adherent (untreated) SKOV3 and OVCA429 cells and SKOV3 and OVCA429 CSCs (Figure 1). CSCs appear round and not attached to the tissue culture plates (Figures 1 and 2). We further show that SKOV3 cells transduced with RFP retain their fluorescence after isolation of the CSCs demonstrating that the cells are viable (Figure 2B).
Viable CSC cultures were assessed for their response to drug therapy. CSCs demonstrated increased resistance to cisplatin (particularly at 100 µM) and paclitaxel (10 µM) (Figure 3). CSCs are often characterized by their expression of stem cell genes. Expression of CD133 (also known as Prom1), Nestin, Nanog, and Oct4 was examined. CD133 was significantly induced in SKOV3 CSC cultures compared to untreated (control) cells (Figure 4A). CD133 was also induced in CSC cultures compared to untreated controls by 16-fold and 13-fold in the OVCA429 and OVCA429-RFP cells (data not shown). In initial experiments Oct4, Nanog, and Nestin were elevated in SKOV3 CSC cultures compared to untreated, but the results were not statistically significant (Figure 4A). Upon repeating these experiments Oct4 and Nanog increased in SKOV3 CSCs compared to parental control cells (Figure 4B). Oct4 was increased by 4.7-fold and 8-fold in the OVCA429 and OVCA429-RFP cells following the CSC enrichment protocol (not shown). Finally, SKOV3 CSCs exhibit increased cell surface expression of the CSC marker CD117 (Figure 5). In conclusion, this method allows for selection of viable spheroid CSCs (expressing stem cell markers) in ovarian cancer cell lines by selection with cisplatin and growth in stem cell media.
Figure 1. Morphology of SKOV3 and OVCA429 cells and cancer stem cells (CSCs) selected from SKOV3 and OVCA429 cells. Phase contrast microscopy depicts SKOV3 and OVCA429 cells (adherent) that are untreated and have been selected for CSCs (spheroid).
Figure 2. Enrichment for CSCs yields non-adherent spheroids. (A) SKOV3 cells untreated and enriched for CSCs (60X magnification). (B) SKOV3-RFP cells that are untreated (a and b) or enriched for CSCs (c and d). Left panels depict phase contrast images and right panels depict fluorescence. Original magnification 40X. Scale bar = 400 microns.
Figure 3. CSCs exhibit increased chemoresistance compared to untreated cell lines. SKOV3 (A and B) and SKOV3-RFP (C and D), SKOV3 CSCs (A and B) and SKOV3-RFP CSCs (C and D) were treated with various concentrations of cisplatin (A and C) or paclitaxel (Taxol) (B and D). 96 hr post treatment MTT assay was performed. Experiments were performed in n≥3 and statistics were calculated using Two Way ANOVA; *p<0.05, ***p<0.0005. Please click here to view a larger version of this figure.
Figure 4. Stem cell marker expression in CSCs compared to untreated cells. QRT-PCR analysis was performed for SKOV3 (control) and SKOV3 CSCs. (A) CD133 (Prom1), Nestin, Nanog, and OCT4 (normalized to GAPDH). (B) An additional experiment demonstrating that the SKOV3-RFP CSCs obtained from this protocol yield cells with elevated OCT4 and Nanog compared to untreated cells. Results were normalized with GAPDH expression. N=3 and statistics were calculated using students T-test; **p<0.02, ***p<0.002.
Figure 5. Flow Cytometry Analysis of stem cell markers in SKOV3 cells and SKOV3 CSCs alone or transduced or without RFP. CD133, CD117, and CD133/CD117 expression in (A) SKOV3 (untreated/control) cells, (B) SKOV3 CSCs, (C) SKOV3-RFP untreated cells, and (D) SKOV3-RFP CSCs. Experiments were performed in triplicate. Please click here to view a larger version of this figure.
CSCs that are resistant to therapy may be accountable for relapse after treatment of primary tumor. Characterization of CSCs may lead to improved therapies for ovarian cancer. The critical parameters in the establishment of chemoresistant CSCs using the above protocol are timing the length of treatment with chemotherapy and the concentration of chemotherapy. When using the protocol in Ma et al. it was found that after 7 days of treatment with cisplatin and paclitaxel, no viable cells remained4. By reducing the treatment to 3 days (with 20 µM cisplatin instead of 40 µM cisplatin and 10 µM paclitaxel), viable chemoresistant cells and CSCs developed. The length and dose of treatment may need to be altered for different ovarian cancer cell lines.
The major limitation of this protocol is the length that the CSCs remain viable. Using this protocol, the CSCs remain viable for less than a week. Therefore, the types of experiments and analysis for the CSCs need to be carefully timed.
Further characterization of the CSCs needs to be conducted. It would be useful to compare this method of CSCs to other methods of CSC generation to determine the similarity and difference between these cell types. Comparison of stem cell markers, response to therapy, and best system for in vivo analysis needs to be conducted between different methods for generating/selection of CSCs. It has been suggested that there are different types of CSCs with different expression patterns of stem cell markers and different prognosis for patients10-12, thus further definition of what type of CSCs are generated by this protocol may help determine how they relate to human malignancy. Finally, in order to rigorously demonstrate that the CSCs isolated from this protocol are definitive CSCs, cells need to be injected into immunocompromised mice in a limiting dilution assay. This assay demonstrates that CSCs are able to generate ovarian tumors at a low density.
The authors have nothing to disclose.
Serene Samyesudhas and Dr. Lynn Roy assisted in preparing samples for filming.
Name of Reagent/ Equipment | Company | Catalog Number | Comments/Description |
McCoy | Life Technologies | 16600-108 | Warm to 37C prior to use |
DMEM / F12 serum free | Life Technologies | 11320-033 | Warm to 37C prior to use |
Minimal Essential Media | Life Technologies | 42360032 | Warm to 37C prior to use |
Sodium Pyruvate | Life Technologies | 11360070 | |
Polybrene | Millipore | TR-1003-G | |
Blasticidin | Life Technologies | R21001 | |
Fetal Bovine Serum | Atlas Biologicals | F-0500-A | |
Penicillin-streptomycin | Life Technologies | 15070-063 | |
Cisplatin | Sigma-Aldrich | T7402-5MG | Caution: Toxic Use precautions |
pLenti-suCMV-Rsv | Gentarget | LVP023 | BSL2 approval needed |
Insulin | Sigma-Aldrich | I-1882 | |
Human Recombinant EGF | Cell Signaling Technology | 8916LC | |
bFGF | BD biosciences | 354060 | |
LIF | Santa Cruz | sc-4988A | |
Bovine Serum Albumin | Roche | 03 116 956 001 | |
TRIzol | Life Technologies | 15596-018 | |
High Capacity cDNA Reverse Transcription Kit | Applied Biosystems | 4368813 | |
IQ Multiplex Powermix | BioRad | 1725849 | |
Accumax | Millipore | ||
Primers | Integrated DNA Technology | individually designed and ordered (see protocol for sequnces) | |
Anti-CD133 PE | Milenyl | 130-098-826 | Primer/probe sets are light sensitive |
CD117-Biotin | Miltenly | 130-098-570 | |
AntiBiotin-FITC | Miltenly | 130-098-796 | |
Paraformaldehyde | Sigma-Aldrich | P6148-1KG | Caution: Toxic always prepare in hood and make fresh. |
Trypsin | Life Technologies | 25300062 | |
MTT (3-(4, 5-Dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide) | Sigma-Aldrich | 25200-072 | |
EVOS Fl Epifluorescence and Transmitted Light Microscope | Advanced Microscopy Group | ||
Biorad CFX96 C1000 System | Biorad | ||
Beckman Coulter FC500 Flow Cytometer | Beckman Coulter | ||
Spectramax 340PC384 | Molecular Devices |